Incidental Mutation 'R2187:Cd2bp2'
ID237871
Institutional Source Beutler Lab
Gene Symbol Cd2bp2
Ensembl Gene ENSMUSG00000042502
Gene NameCD2 antigen (cytoplasmic tail) binding protein 2
Synonyms
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127191660-127196050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127194791 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 109 (N109D)
Ref Sequence ENSEMBL: ENSMUSP00000044790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035771] [ENSMUST00000120705] [ENSMUST00000166791] [ENSMUST00000205316] [ENSMUST00000205321] [ENSMUST00000205355] [ENSMUST00000206026] [ENSMUST00000206081] [ENSMUST00000206587]
Predicted Effect probably benign
Transcript: ENSMUST00000035771
AA Change: N109D

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044790
Gene: ENSMUSG00000042502
AA Change: N109D

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120705
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153857
Predicted Effect probably benign
Transcript: ENSMUST00000166791
AA Change: N109D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132963
Gene: ENSMUSG00000042502
AA Change: N109D

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 156 165 N/A INTRINSIC
low complexity region 172 193 N/A INTRINSIC
GYF 282 339 7.35e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175164
Predicted Effect probably benign
Transcript: ENSMUST00000205316
AA Change: N109D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000205321
AA Change: N109D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000205355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205525
Predicted Effect probably benign
Transcript: ENSMUST00000205620
Predicted Effect probably benign
Transcript: ENSMUST00000206026
AA Change: N109D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000206081
Predicted Effect probably benign
Transcript: ENSMUST00000206587
AA Change: N109D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bi-functional protein. In the cytoplasm, the encoded protein binds the cytoplasmic tail of human surface antigen CD2 via its C-terminal GYF domain, and regulate CD2-triggered T lymphocyte activation. In the nucleus, this protein is a component of the U5 small nuclear ribonucleoprotein complex and is involved in RNA splicing. A pseudogene has been identified on chromosome 7. Alternative splicing results in multiple transcript variants but their biological validity has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Cd2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0201:Cd2bp2 UTSW 7 127193828 missense probably damaging 1.00
R0550:Cd2bp2 UTSW 7 127193824 missense probably damaging 1.00
R0674:Cd2bp2 UTSW 7 127194836 missense probably damaging 1.00
R1929:Cd2bp2 UTSW 7 127193878 missense probably benign 0.22
R5877:Cd2bp2 UTSW 7 127194799 missense probably damaging 1.00
R6049:Cd2bp2 UTSW 7 127193835 missense probably damaging 1.00
R6109:Cd2bp2 UTSW 7 127194815 missense probably damaging 1.00
R7008:Cd2bp2 UTSW 7 127195395 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCTCCTCCGAGTCTGAAAC -3'
(R):5'- ACAAGCCTTCAGGATGGAGG -3'

Sequencing Primer
(F):5'- AGTCTGAAACCTGGTGCTTATCAG -3'
(R):5'- CCTTCAGGATGGAGGTGGGAG -3'
Posted On2014-10-02