Incidental Mutation 'R2187:Nup93'
ID237873
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Namenucleoporin 93
Synonyms2410008G02Rik
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94214564-94317227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94300850 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 295 (S295R)
Ref Sequence ENSEMBL: ENSMUSP00000148700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
Predicted Effect probably damaging
Transcript: ENSMUST00000079961
AA Change: S295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: S295R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109547
AA Change: S295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: S295R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211822
AA Change: S172R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212824
AA Change: S295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 94309023 critical splice donor site probably null
IGL01652:Nup93 APN 8 94296559 missense possibly damaging 0.93
IGL02003:Nup93 APN 8 94302109 nonsense probably null
IGL02169:Nup93 APN 8 94302129 missense probably damaging 1.00
IGL02212:Nup93 APN 8 94311662 critical splice donor site probably null
IGL02551:Nup93 APN 8 94227833 nonsense probably null
IGL02568:Nup93 APN 8 94309635 missense probably damaging 1.00
IGL03094:Nup93 APN 8 94296502 missense probably benign
IGL03248:Nup93 APN 8 94306088 missense probably damaging 0.98
IGL03273:Nup93 APN 8 94306277 missense probably benign 0.01
IGL03401:Nup93 APN 8 94309711 splice site probably null
PIT4585001:Nup93 UTSW 8 94243727 missense probably benign 0.25
R0409:Nup93 UTSW 8 94303665 missense probably damaging 1.00
R0748:Nup93 UTSW 8 94307943 missense probably damaging 1.00
R0891:Nup93 UTSW 8 94281263 splice site probably benign
R1667:Nup93 UTSW 8 94292687 missense possibly damaging 0.71
R1696:Nup93 UTSW 8 94296555 missense probably benign 0.29
R1862:Nup93 UTSW 8 94306102 missense probably damaging 1.00
R2069:Nup93 UTSW 8 94243739 missense probably damaging 1.00
R2143:Nup93 UTSW 8 94296480 nonsense probably null
R2228:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2229:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2254:Nup93 UTSW 8 94227857 critical splice donor site probably null
R2884:Nup93 UTSW 8 94303638 missense probably damaging 1.00
R4521:Nup93 UTSW 8 94314636 missense probably damaging 1.00
R4563:Nup93 UTSW 8 94307892 missense probably damaging 1.00
R4900:Nup93 UTSW 8 94286603 missense probably benign 0.25
R5570:Nup93 UTSW 8 94314670 missense probably damaging 1.00
R6226:Nup93 UTSW 8 94286537 missense probably damaging 1.00
R6489:Nup93 UTSW 8 94302088 missense probably benign 0.10
R6658:Nup93 UTSW 8 94304179 missense probably benign 0.02
R6817:Nup93 UTSW 8 94314682 critical splice donor site probably null
R6895:Nup93 UTSW 8 94243686 missense probably damaging 1.00
R6955:Nup93 UTSW 8 94309673 missense probably damaging 0.96
R7476:Nup93 UTSW 8 94303632 missense probably damaging 1.00
R7643:Nup93 UTSW 8 94286619 critical splice donor site probably null
R7994:Nup93 UTSW 8 94306302 missense probably benign 0.15
R8461:Nup93 UTSW 8 94281335 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAACTCAGAGTCATGTGTTCTG -3'
(R):5'- ACATGGTGTTGGCACATCTC -3'

Sequencing Primer
(F):5'- CTCAGAGTCATGTGTTCTGAACATG -3'
(R):5'- CTACTCAGGATTTTTGCATGACTG -3'
Posted On2014-10-02