Mutagenetix > Incidental Mutation

Incidental Mutation 'R2187:Rad54l2'

237878

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

040189-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2187 (G1)

Quality Score

105

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

ACCTCCTCCTCCTCCTCCTCCTCCTC to ACCTCCTCCTCCTCCTCCTCCTC at 106753992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046502

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	A	G	3: 92,868,615	S254P	probably damaging	Het
Abcg1	T	A	17: 31,105,517	S245R	probably damaging	Het
AI597479	T	A	1: 43,100,823	W70R	probably damaging	Het
Ankrd55	A	G	13: 112,383,505	S575G	probably benign	Het
Bfsp2	T	A	9: 103,426,777	K343*	probably null	Het
Cant1	A	T	11: 118,408,841	Y227*	probably null	Het
Cd2bp2	T	C	7: 127,194,791	N109D	probably benign	Het
Chmp6	A	G	11: 119,916,736	E135G	possibly damaging	Het
Dsp	T	G	13: 38,176,407	S329R	probably damaging	Het
Epha5	A	T	5: 84,086,364	F767L	probably damaging	Het
Epha7	A	T	4: 28,942,648	T566S	possibly damaging	Het
Erap1	A	T	13: 74,662,405	I288F	probably damaging	Het
Erich6	A	G	3: 58,629,845		probably null	Het
Fbxo10	A	G	4: 45,058,531	V402A	probably benign	Het
Fndc1	T	A	17: 7,741,772	I1604F	probably damaging	Het
Foxd4	T	G	19: 24,899,855	Q327P	probably damaging	Het
Fxn	T	A	19: 24,280,489	N26I	probably benign	Het
Hsf5	G	T	11: 87,638,184	G582C	possibly damaging	Het
Itga8	A	G	2: 12,194,420	V522A	possibly damaging	Het
Lyst	C	T	13: 13,709,341	T2938I	possibly damaging	Het
Mib2	T	C	4: 155,654,933	E863G	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,049	F290S	probably damaging	Het
Mst1	T	C	9: 108,084,340	Y599H	possibly damaging	Het
Mylk4	T	C	13: 32,722,013	I165V	probably damaging	Het
Nipsnap2	T	C	5: 129,746,473		probably null	Het
Nol8	T	C	13: 49,661,999	Y528H	probably benign	Het
Nup93	T	A	8: 94,300,850	S295R	probably damaging	Het
Nutm2	A	T	13: 50,467,417	Q6L	probably benign	Het
Olfr11	A	T	13: 21,639,385	I46N	probably damaging	Het
Olfr1445	T	A	19: 12,884,255	C125S	probably damaging	Het
Olfr820	A	G	10: 130,017,688	E109G	probably damaging	Het
Olfr988	T	G	2: 85,353,915	S4R	probably benign	Het
Pip5k1a	A	T	3: 95,071,918	L189Q	probably damaging	Het
Plekha4	C	T	7: 45,549,274	R574C	probably damaging	Het
Ppp2cb	A	G	8: 33,610,677	E42G	possibly damaging	Het
Prkd3	T	A	17: 78,975,554	Q244L	probably benign	Het
Ptpn14	C	T	1: 189,863,228	R1023*	probably null	Het
Ptpra	A	G	2: 130,504,299	T127A	probably benign	Het
Rasgrf1	T	C	9: 89,994,835	I751T	possibly damaging	Het
Rbm27	A	G	18: 42,325,957	K697R	probably damaging	Het
Rhoa	C	T	9: 108,335,153	T127M	probably benign	Het
Rnpepl1	A	G	1: 92,916,895	S370G	probably null	Het
Sdk1	C	T	5: 142,114,574	T1453I	probably damaging	Het
Sel1l2	A	G	2: 140,230,873	L614S	probably damaging	Het
Slc6a20b	T	A	9: 123,598,588	I419F	probably damaging	Het
Slc8a1	C	T	17: 81,648,553	S352N	possibly damaging	Het
Spta1	A	G	1: 174,192,966	D547G	probably damaging	Het
Tc2n	G	A	12: 101,706,544	T46I	probably damaging	Het
Terb1	T	A	8: 104,472,884	Y476F	probably benign	Het
Trim12a	T	A	7: 104,304,192	E237D	probably damaging	Het
Usp47	T	C	7: 112,067,191	L309P	probably damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGTTCTGTGGCCCTTTCC -3'
(R):5'- AAGTGCAGCTGTGGTGATTC -3'

Sequencing Primer
(F):5'- AAACCTGGTTGACAGTGAGTTCC -3'
(R):5'- GGTGATTCTGATGCCTCTTGACC -3'

Posted On

2014-10-02