Incidental Mutation 'R2187:Rhoa'
ID237880
Institutional Source Beutler Lab
Gene Symbol Rhoa
Ensembl Gene ENSMUSG00000007815
Gene Nameras homolog family member A
SynonymsArha1, RhoA, Arha2, Arha
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108306129-108337934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108335153 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 127 (T127M)
Ref Sequence ENSEMBL: ENSMUSP00000141967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007959] [ENSMUST00000082429] [ENSMUST00000191997] [ENSMUST00000193490] [ENSMUST00000193987] [ENSMUST00000194701]
Predicted Effect probably benign
Transcript: ENSMUST00000007959
AA Change: T127M

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000007959
Gene: ENSMUSG00000007815
AA Change: T127M

DomainStartEndE-ValueType
RHO 8 181 1.09e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082429
SMART Domains Protein: ENSMUSP00000081010
Gene: ENSMUSG00000063856

DomainStartEndE-ValueType
Pfam:GSHPx 14 128 5.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191755
Predicted Effect probably benign
Transcript: ENSMUST00000191997
SMART Domains Protein: ENSMUSP00000142257
Gene: ENSMUSG00000063856

DomainStartEndE-ValueType
Pfam:GSHPx 1 71 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193424
Predicted Effect probably benign
Transcript: ENSMUST00000193490
SMART Domains Protein: ENSMUSP00000141572
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
small_GTPase 8 67 1.5e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193987
SMART Domains Protein: ENSMUSP00000141279
Gene: ENSMUSG00000063856

DomainStartEndE-ValueType
Pfam:GSHPx 1 72 6.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194701
AA Change: T127M

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141967
Gene: ENSMUSG00000007815
AA Change: T127M

DomainStartEndE-ValueType
RHO 8 165 8.9e-117 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants have been identified. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in neuroepithelial cells exhibit lethality during late embryonic stages associated with early cell cycle exit, premature neuronal precursor differentiation, increased apoptosis in the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Rhoa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4403:Rhoa UTSW 9 108336814 missense probably benign 0.09
R7749:Rhoa UTSW 9 108336715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCCCAAATGTTTCTTTG -3'
(R):5'- TGTCCTGGACACTGAGTACG -3'

Sequencing Primer
(F):5'- GTCCTCAGGCTCAGATTCAAG -3'
(R):5'- CTGGACACTGAGTACGGGAAAC -3'
Posted On2014-10-02