Incidental Mutation 'R2187:Slc6a20b'
ID237881
Institutional Source Beutler Lab
Gene Symbol Slc6a20b
Ensembl Gene ENSMUSG00000025243
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20B
SynonymsSit1, XT3, Xtrp3, Slc6a20
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123590800-123632565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123598588 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 419 (I419F)
Ref Sequence ENSEMBL: ENSMUSP00000026273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026273] [ENSMUST00000166800]
Predicted Effect probably damaging
Transcript: ENSMUST00000026273
AA Change: I419F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243
AA Change: I419F

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166800
AA Change: I419F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171122
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Slc6a20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Slc6a20b APN 9 123597240 missense probably damaging 1.00
IGL02741:Slc6a20b APN 9 123607602 missense probably damaging 1.00
IGL03038:Slc6a20b APN 9 123597329 missense possibly damaging 0.55
IGL03115:Slc6a20b APN 9 123597338 missense possibly damaging 0.82
IGL03228:Slc6a20b APN 9 123632132 nonsense probably null
PIT4131001:Slc6a20b UTSW 9 123612126 missense probably benign 0.00
R0653:Slc6a20b UTSW 9 123597312 missense probably damaging 1.00
R1072:Slc6a20b UTSW 9 123598459 missense probably damaging 0.97
R1759:Slc6a20b UTSW 9 123608997 critical splice donor site probably null
R1889:Slc6a20b UTSW 9 123632204 missense probably benign 0.02
R2075:Slc6a20b UTSW 9 123595034 missense probably benign 0.13
R4097:Slc6a20b UTSW 9 123612757 utr 3 prime probably benign
R4762:Slc6a20b UTSW 9 123598560 missense probably damaging 1.00
R4834:Slc6a20b UTSW 9 123596048 missense probably benign 0.00
R4932:Slc6a20b UTSW 9 123604796 missense probably damaging 1.00
R5079:Slc6a20b UTSW 9 123598498 missense probably damaging 1.00
R5095:Slc6a20b UTSW 9 123595054 missense probably benign
R5307:Slc6a20b UTSW 9 123603834 missense possibly damaging 0.62
R5721:Slc6a20b UTSW 9 123611989 missense probably null 1.00
R6108:Slc6a20b UTSW 9 123596186 missense probably benign 0.01
R6285:Slc6a20b UTSW 9 123609096 missense possibly damaging 0.81
R6463:Slc6a20b UTSW 9 123604949 missense possibly damaging 0.62
R7050:Slc6a20b UTSW 9 123598543 missense probably damaging 1.00
R7411:Slc6a20b UTSW 9 123604948 missense probably benign 0.32
R7422:Slc6a20b UTSW 9 123607617 missense possibly damaging 0.95
R7460:Slc6a20b UTSW 9 123604949 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGAAATGGCCTCCTTG -3'
(R):5'- GCAGGGTTCATCACAGTGTG -3'

Sequencing Primer
(F):5'- CTCCTTGGGCAGGTAGCTG -3'
(R):5'- TGTGTGTGTGTTGGCTAGC -3'
Posted On2014-10-02