Incidental Mutation 'R2187:Tc2n'
ID237888
Institutional Source Beutler Lab
Gene Symbol Tc2n
Ensembl Gene ENSMUSG00000021187
Gene Nametandem C2 domains, nuclear
Synonyms4933406D09Rik, Tac2-N, Mtac2d1
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101645443-101718523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101706544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 46 (T46I)
Ref Sequence ENSEMBL: ENSMUSP00000125099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110047] [ENSMUST00000160715] [ENSMUST00000160830] [ENSMUST00000162735]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110047
AA Change: T46I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105674
Gene: ENSMUSG00000021187
AA Change: T46I

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160715
AA Change: T46I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125099
Gene: ENSMUSG00000021187
AA Change: T46I

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
Blast:C2 238 287 1e-24 BLAST
C2 302 408 1.02e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160830
AA Change: T46I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124287
Gene: ENSMUSG00000021187
AA Change: T46I

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162735
AA Change: T46I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125288
Gene: ENSMUSG00000021187
AA Change: T46I

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Tc2n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tc2n APN 12 101649089 utr 3 prime probably benign
IGL02129:Tc2n APN 12 101689789 missense probably damaging 0.99
IGL02630:Tc2n APN 12 101693145 missense probably damaging 0.99
upbraided UTSW 12 101651201 splice site probably null
R0517:Tc2n UTSW 12 101649195 missense probably damaging 0.98
R0980:Tc2n UTSW 12 101678576 nonsense probably null
R1676:Tc2n UTSW 12 101688992 missense probably damaging 1.00
R3771:Tc2n UTSW 12 101694574 missense possibly damaging 0.68
R4082:Tc2n UTSW 12 101651155 missense possibly damaging 0.85
R4180:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R4707:Tc2n UTSW 12 101694573 missense probably benign 0.16
R4793:Tc2n UTSW 12 101651117 missense possibly damaging 0.86
R4917:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R5214:Tc2n UTSW 12 101693202 nonsense probably null
R5870:Tc2n UTSW 12 101652852 missense probably damaging 1.00
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6128:Tc2n UTSW 12 101709489 start codon destroyed probably null 0.99
R7200:Tc2n UTSW 12 101689055 missense probably damaging 1.00
R7469:Tc2n UTSW 12 101665675 missense probably damaging 1.00
R7471:Tc2n UTSW 12 101706457 missense probably damaging 0.99
R7730:Tc2n UTSW 12 101651147 missense probably damaging 0.99
R7836:Tc2n UTSW 12 101652853 missense possibly damaging 0.51
R8432:Tc2n UTSW 12 101649104 missense probably benign 0.00
R8435:Tc2n UTSW 12 101649117 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACTTAAATGGTTCATGTTGAC -3'
(R):5'- GGAATGGGGATAACATTTAAAATGCA -3'

Sequencing Primer
(F):5'- GGTTCATGTTGACTTTTAAATCCTG -3'
(R):5'- ATGTTCCAGGTGGCACATAC -3'
Posted On2014-10-02