Incidental Mutation 'R2187:Olfr11'
ID237890
Institutional Source Beutler Lab
Gene Symbol Olfr11
Ensembl Gene ENSMUSG00000036658
Gene Nameolfactory receptor 11
SynonymsGA_x6K02T2QHY8-11597382-11598323, MOR256-11
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21636623-21642518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21639385 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 46 (I46N)
Ref Sequence ENSEMBL: ENSMUSP00000146091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043081] [ENSMUST00000205631]
Predicted Effect probably damaging
Transcript: ENSMUST00000043081
AA Change: I46N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043099
Gene: ENSMUSG00000036658
AA Change: I46N

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 4.9e-51 PFAM
Pfam:7tm_1 41 290 7.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205631
AA Change: I46N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Olfr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Olfr11 APN 13 21639340 missense probably damaging 1.00
R0513:Olfr11 UTSW 13 21638949 missense probably benign 0.26
R0928:Olfr11 UTSW 13 21638956 missense probably damaging 1.00
R1440:Olfr11 UTSW 13 21639390 missense probably benign 0.11
R1673:Olfr11 UTSW 13 21639044 missense probably damaging 1.00
R1705:Olfr11 UTSW 13 21639161 missense probably damaging 1.00
R2080:Olfr11 UTSW 13 21639436 missense probably damaging 0.99
R2283:Olfr11 UTSW 13 21639020 missense probably damaging 1.00
R2340:Olfr11 UTSW 13 21638587 missense probably benign 0.03
R3690:Olfr11 UTSW 13 21639338 missense probably damaging 1.00
R4108:Olfr11 UTSW 13 21638782 missense probably damaging 1.00
R4739:Olfr11 UTSW 13 21639170 missense possibly damaging 0.90
R4740:Olfr11 UTSW 13 21639170 missense possibly damaging 0.90
R5335:Olfr11 UTSW 13 21638779 missense probably damaging 1.00
R5790:Olfr11 UTSW 13 21638876 missense probably benign
R6320:Olfr11 UTSW 13 21639248 missense probably damaging 1.00
R7406:Olfr11 UTSW 13 21639146 missense probably benign 0.16
R7508:Olfr11 UTSW 13 21638609 missense probably benign 0.19
R8054:Olfr11 UTSW 13 21638949 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGAACACACTCGGTAGCCC -3'
(R):5'- GGCATGGGCACAGAAACTTTAG -3'

Sequencing Primer
(F):5'- ACTCGGTAGCCCCCAATG -3'
(R):5'- GTGTGTAACTAACAATACCAGTTGC -3'
Posted On2014-10-02