Incidental Mutation 'R2187:Mylk4'
ID237891
Institutional Source Beutler Lab
Gene Symbol Mylk4
Ensembl Gene ENSMUSG00000044951
Gene Namemyosin light chain kinase family, member 4
SynonymsEG238564
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location32700834-32783954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32722013 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 165 (I165V)
Ref Sequence ENSEMBL: ENSMUSP00000060149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057428] [ENSMUST00000230119]
Predicted Effect probably damaging
Transcript: ENSMUST00000057428
AA Change: I165V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060149
Gene: ENSMUSG00000044951
AA Change: I165V

DomainStartEndE-ValueType
S_TKc 107 362 4.2e-90 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134352
AA Change: I165V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116013
Gene: ENSMUSG00000044951
AA Change: I165V

DomainStartEndE-ValueType
S_TKc 107 361 1.01e-83 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000230119
AA Change: I396V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Mylk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Mylk4 APN 13 32715922 missense probably damaging 1.00
IGL01799:Mylk4 APN 13 32781691 missense probably benign 0.00
IGL01985:Mylk4 APN 13 32717581 missense possibly damaging 0.81
IGL02105:Mylk4 APN 13 32720562 missense probably benign 0.17
IGL02270:Mylk4 APN 13 32729066 splice site probably benign
IGL02377:Mylk4 APN 13 32722147 missense possibly damaging 0.69
IGL03142:Mylk4 APN 13 32720599 missense probably damaging 1.00
R0550:Mylk4 UTSW 13 32716666 missense probably benign 0.00
R0599:Mylk4 UTSW 13 32712754 splice site probably null
R1070:Mylk4 UTSW 13 32724818 missense probably benign 0.05
R1520:Mylk4 UTSW 13 32712838 splice site probably null
R1658:Mylk4 UTSW 13 32712789 missense possibly damaging 0.77
R1917:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1918:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1919:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R2568:Mylk4 UTSW 13 32722018 missense probably null 0.97
R4832:Mylk4 UTSW 13 32721977 missense probably benign 0.04
R5268:Mylk4 UTSW 13 32708881 splice site probably null
R6801:Mylk4 UTSW 13 32728410 missense probably benign 0.07
R6894:Mylk4 UTSW 13 32722015 missense probably damaging 1.00
R7302:Mylk4 UTSW 13 32720565 missense probably benign 0.39
R7329:Mylk4 UTSW 13 32716783 missense probably damaging 1.00
R7634:Mylk4 UTSW 13 32708908 missense possibly damaging 0.88
R7702:Mylk4 UTSW 13 32720602 critical splice acceptor site probably null
R7944:Mylk4 UTSW 13 32727113 missense probably benign 0.02
R8256:Mylk4 UTSW 13 32720539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGACCCTGGCAAGATCC -3'
(R):5'- AACTGTCTCTTCTTTGGCAGGG -3'

Sequencing Primer
(F):5'- TGGCAAGATCCCATGTCTCTGG -3'
(R):5'- AACAGGCCTGAAGCTGGC -3'
Posted On2014-10-02