Mutagenetix > Incidental Mutation

Incidental Mutation 'R2187:Nol8'

237893

Institutional Source

Beutler Lab

Gene Symbol

Nol8

Ensembl Gene

ENSMUSG00000021392

Gene Name

nucleolar protein 8

Synonyms

5730412B09Rik, D13Ertd548e, 4921532D18Rik

MMRRC Submission

040189-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2187 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49653078-49679016 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49661999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 528 (Y528H)

Ref Sequence

ENSEMBL: ENSMUSP00000152536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223467]

AlphaFold

Q3UHX0

Predicted Effect

probably benign
Transcript: ENSMUST00000021824
AA Change: Y528H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: Y528H

Domain	Start	End	E-Value	Type
RRM	27	103	3.02e-9	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	454	468	N/A	INTRINSIC
low complexity region	712	724	N/A	INTRINSIC
low complexity region	804	816	N/A	INTRINSIC
low complexity region	836	849	N/A	INTRINSIC
coiled coil region	886	916	N/A	INTRINSIC
coiled coil region	955	981	N/A	INTRINSIC
low complexity region	1080	1093	N/A	INTRINSIC
low complexity region	1152	1164	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221083

Predicted Effect

probably benign
Transcript: ENSMUST00000221142
AA Change: Y510H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000222197
AA Change: Y528H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000222333

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223346

Predicted Effect

probably benign
Transcript: ENSMUST00000223467
AA Change: Y510H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	A	G	3: 92,868,615	S254P	probably damaging	Het
Abcg1	T	A	17: 31,105,517	S245R	probably damaging	Het
AI597479	T	A	1: 43,100,823	W70R	probably damaging	Het
Ankrd55	A	G	13: 112,383,505	S575G	probably benign	Het
Bfsp2	T	A	9: 103,426,777	K343*	probably null	Het
Cant1	A	T	11: 118,408,841	Y227*	probably null	Het
Cd2bp2	T	C	7: 127,194,791	N109D	probably benign	Het
Chmp6	A	G	11: 119,916,736	E135G	possibly damaging	Het
Dsp	T	G	13: 38,176,407	S329R	probably damaging	Het
Epha5	A	T	5: 84,086,364	F767L	probably damaging	Het
Epha7	A	T	4: 28,942,648	T566S	possibly damaging	Het
Erap1	A	T	13: 74,662,405	I288F	probably damaging	Het
Erich6	A	G	3: 58,629,845		probably null	Het
Fbxo10	A	G	4: 45,058,531	V402A	probably benign	Het
Fndc1	T	A	17: 7,741,772	I1604F	probably damaging	Het
Foxd4	T	G	19: 24,899,855	Q327P	probably damaging	Het
Fxn	T	A	19: 24,280,489	N26I	probably benign	Het
Hsf5	G	T	11: 87,638,184	G582C	possibly damaging	Het
Itga8	A	G	2: 12,194,420	V522A	possibly damaging	Het
Lyst	C	T	13: 13,709,341	T2938I	possibly damaging	Het
Mib2	T	C	4: 155,654,933	E863G	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,049	F290S	probably damaging	Het
Mst1	T	C	9: 108,084,340	Y599H	possibly damaging	Het
Mylk4	T	C	13: 32,722,013	I165V	probably damaging	Het
Nipsnap2	T	C	5: 129,746,473		probably null	Het
Nup93	T	A	8: 94,300,850	S295R	probably damaging	Het
Nutm2	A	T	13: 50,467,417	Q6L	probably benign	Het
Olfr11	A	T	13: 21,639,385	I46N	probably damaging	Het
Olfr1445	T	A	19: 12,884,255	C125S	probably damaging	Het
Olfr820	A	G	10: 130,017,688	E109G	probably damaging	Het
Olfr988	T	G	2: 85,353,915	S4R	probably benign	Het
Pip5k1a	A	T	3: 95,071,918	L189Q	probably damaging	Het
Plekha4	C	T	7: 45,549,274	R574C	probably damaging	Het
Ppp2cb	A	G	8: 33,610,677	E42G	possibly damaging	Het
Prkd3	T	A	17: 78,975,554	Q244L	probably benign	Het
Ptpn14	C	T	1: 189,863,228	R1023*	probably null	Het
Ptpra	A	G	2: 130,504,299	T127A	probably benign	Het
Rad54l2	ACCTCCTCCTCCTCCTCCTCCTCCTC	ACCTCCTCCTCCTCCTCCTCCTC	9: 106,753,992		probably benign	Het
Rasgrf1	T	C	9: 89,994,835	I751T	possibly damaging	Het
Rbm27	A	G	18: 42,325,957	K697R	probably damaging	Het
Rhoa	C	T	9: 108,335,153	T127M	probably benign	Het
Rnpepl1	A	G	1: 92,916,895	S370G	probably null	Het
Sdk1	C	T	5: 142,114,574	T1453I	probably damaging	Het
Sel1l2	A	G	2: 140,230,873	L614S	probably damaging	Het
Slc6a20b	T	A	9: 123,598,588	I419F	probably damaging	Het
Slc8a1	C	T	17: 81,648,553	S352N	possibly damaging	Het
Spta1	A	G	1: 174,192,966	D547G	probably damaging	Het
Tc2n	G	A	12: 101,706,544	T46I	probably damaging	Het
Terb1	T	A	8: 104,472,884	Y476F	probably benign	Het
Trim12a	T	A	7: 104,304,192	E237D	probably damaging	Het
Usp47	T	C	7: 112,067,191	L309P	probably damaging	Het

Other mutations in Nol8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Nol8	APN	13	49662228	missense	probably benign	0.01
IGL01106:Nol8	APN	13	49654481	missense	possibly damaging	0.46
IGL01413:Nol8	APN	13	49659952	missense	possibly damaging	0.82
IGL01540:Nol8	APN	13	49661670	missense	probably benign	0.06
IGL01670:Nol8	APN	13	49661308	missense	possibly damaging	0.54
IGL01672:Nol8	APN	13	49675407	missense	possibly damaging	0.95
IGL02032:Nol8	APN	13	49672772	missense	probably benign
IGL02212:Nol8	APN	13	49662150	missense	possibly damaging	0.87
IGL02323:Nol8	APN	13	49655245	splice site	probably benign
IGL02645:Nol8	APN	13	49665471	critical splice donor site	probably null
IGL02949:Nol8	APN	13	49662402	missense	probably benign	0.01
IGL02954:Nol8	APN	13	49661172	missense	probably benign	0.01
IGL03182:Nol8	APN	13	49664081	missense	probably damaging	1.00
IGL03406:Nol8	APN	13	49661568	missense	probably damaging	1.00
P0047:Nol8	UTSW	13	49654348	splice site	probably null
R0092:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0099:Nol8	UTSW	13	49672689	missense	probably benign
R0145:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0269:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0370:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0374:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0390:Nol8	UTSW	13	49662152	missense	probably damaging	1.00
R0617:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0635:Nol8	UTSW	13	49676758	missense	probably benign	0.05
R0637:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R1246:Nol8	UTSW	13	49676769	missense	probably damaging	1.00
R1446:Nol8	UTSW	13	49655227	missense	probably damaging	1.00
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1627:Nol8	UTSW	13	49661504	missense	probably benign	0.01
R1703:Nol8	UTSW	13	49667457	missense	possibly damaging	0.65
R1751:Nol8	UTSW	13	49667408	missense	probably benign	0.06
R2357:Nol8	UTSW	13	49654504	critical splice donor site	probably null
R3081:Nol8	UTSW	13	49678392	unclassified	probably benign
R3969:Nol8	UTSW	13	49660016	nonsense	probably null
R4199:Nol8	UTSW	13	49661748	missense	possibly damaging	0.65
R4720:Nol8	UTSW	13	49662753	missense	probably damaging	1.00
R4927:Nol8	UTSW	13	49654425	missense	possibly damaging	0.79
R5177:Nol8	UTSW	13	49661112	missense	probably benign	0.32
R5512:Nol8	UTSW	13	49676787	missense	probably benign
R5744:Nol8	UTSW	13	49662326	missense	possibly damaging	0.82
R5988:Nol8	UTSW	13	49672614	missense	possibly damaging	0.58
R6048:Nol8	UTSW	13	49653684	critical splice donor site	probably null
R6306:Nol8	UTSW	13	49676353	missense	probably damaging	1.00
R6359:Nol8	UTSW	13	49664070	missense	probably benign	0.16
R6378:Nol8	UTSW	13	49667355	missense	probably damaging	1.00
R6655:Nol8	UTSW	13	49654392	missense	probably damaging	1.00
R7035:Nol8	UTSW	13	49661202	missense	probably benign	0.06
R7058:Nol8	UTSW	13	49676386	missense	probably damaging	1.00
R7368:Nol8	UTSW	13	49661219	missense	probably benign	0.00
R7450:Nol8	UTSW	13	49660015	missense	probably benign	0.01
R7673:Nol8	UTSW	13	49664780	missense	probably benign	0.15
R7750:Nol8	UTSW	13	49662266	missense	possibly damaging	0.83
R8246:Nol8	UTSW	13	49655248	splice site	probably benign
R9081:Nol8	UTSW	13	49661405	missense	probably benign	0.00
R9127:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R9223:Nol8	UTSW	13	49661262	missense	possibly damaging	0.63
X0020:Nol8	UTSW	13	49661165	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGTGACAGTGAAGAGTCCG -3'
(R):5'- AAGGAACTGTGATGCCCACC -3'

Sequencing Primer
(F):5'- TGACAGTGAAGAGTCCGAAGAAGATG -3'
(R):5'- CCGCCAGTATTAAAGGCAATATTCTC -3'

Posted On

2014-10-02