Incidental Mutation 'R2187:Nutm2'
ID237894
Institutional Source Beutler Lab
Gene Symbol Nutm2
Ensembl Gene ENSMUSG00000071909
Gene NameNUT family member 2
SynonymsLOC328250, Gm806
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location50467307-50475355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50467417 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 6 (Q6L)
Ref Sequence ENSEMBL: ENSMUSP00000094390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096633]
Predicted Effect probably benign
Transcript: ENSMUST00000096633
AA Change: Q6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000094390
Gene: ENSMUSG00000071909
AA Change: Q6L

DomainStartEndE-ValueType
Pfam:NUT 27 733 9e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185962
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Nutm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nutm2 APN 13 50474860 missense probably benign 0.18
IGL01087:Nutm2 APN 13 50469629 missense probably damaging 1.00
IGL01707:Nutm2 APN 13 50469717 missense probably damaging 0.96
IGL02085:Nutm2 APN 13 50473793 splice site probably null
IGL02238:Nutm2 APN 13 50471039 missense probably damaging 1.00
IGL02369:Nutm2 APN 13 50469908 missense probably benign 0.16
IGL02429:Nutm2 APN 13 50469480 missense probably benign 0.44
IGL03083:Nutm2 APN 13 50467444 missense probably damaging 0.98
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0321:Nutm2 UTSW 13 50472955 missense probably damaging 0.98
R1481:Nutm2 UTSW 13 50469481 missense probably damaging 0.99
R1605:Nutm2 UTSW 13 50469919 missense possibly damaging 0.68
R1679:Nutm2 UTSW 13 50469386 missense probably benign 0.17
R1744:Nutm2 UTSW 13 50469354 missense probably benign 0.03
R1768:Nutm2 UTSW 13 50473116 missense probably damaging 1.00
R1969:Nutm2 UTSW 13 50473842 missense probably damaging 1.00
R2026:Nutm2 UTSW 13 50474820 missense probably benign 0.00
R3912:Nutm2 UTSW 13 50472940 missense possibly damaging 0.92
R4025:Nutm2 UTSW 13 50469353 missense probably benign
R4367:Nutm2 UTSW 13 50469884 missense probably benign 0.01
R4668:Nutm2 UTSW 13 50472997 missense probably benign 0.18
R4940:Nutm2 UTSW 13 50474873 missense possibly damaging 0.58
R4987:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R4988:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R5821:Nutm2 UTSW 13 50469855 missense probably benign 0.01
R5986:Nutm2 UTSW 13 50474460 missense probably damaging 1.00
R6189:Nutm2 UTSW 13 50469738 missense possibly damaging 0.91
R7101:Nutm2 UTSW 13 50472898 missense probably benign 0.00
R7192:Nutm2 UTSW 13 50473069 missense probably damaging 1.00
R7394:Nutm2 UTSW 13 50470007 missense probably damaging 1.00
R7591:Nutm2 UTSW 13 50473867 missense probably damaging 0.98
R8217:Nutm2 UTSW 13 50469723 missense probably benign 0.16
R8347:Nutm2 UTSW 13 50472337 missense probably benign 0.05
X0028:Nutm2 UTSW 13 50472954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCAAGGTTCTTATGCACCTG -3'
(R):5'- CTTCACAGTGGGATGTCCTTG -3'

Sequencing Primer
(F):5'- GGAATGTTCCCCCAGTCCTG -3'
(R):5'- ATGTCCTTGCAGAAGTCCAG -3'
Posted On2014-10-02