Incidental Mutation 'R2187:Ankrd55'
ID237896
Institutional Source Beutler Lab
Gene Symbol Ankrd55
Ensembl Gene ENSMUSG00000049985
Gene Nameankyrin repeat domain 55
SynonymsC030011J08Rik
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112288451-112384002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112383505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 575 (S575G)
Ref Sequence ENSEMBL: ENSMUSP00000126199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022275] [ENSMUST00000165593]
Predicted Effect unknown
Transcript: ENSMUST00000022275
AA Change: S603G
SMART Domains Protein: ENSMUSP00000022275
Gene: ENSMUSG00000049985
AA Change: S603G

DomainStartEndE-ValueType
Blast:ANK 25 54 1e-9 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
ANK 263 292 5.71e-5 SMART
ANK 296 326 1.63e0 SMART
low complexity region 528 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165593
AA Change: S575G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126199
Gene: ENSMUSG00000049985
AA Change: S575G

DomainStartEndE-ValueType
Blast:ANK 1 26 8e-8 BLAST
ANK 31 60 7.64e-6 SMART
ANK 64 93 4.18e2 SMART
ANK 97 128 4.86e1 SMART
ANK 132 161 5.32e-5 SMART
ANK 165 194 7.59e-1 SMART
ANK 201 229 2.97e2 SMART
ANK 235 264 5.71e-5 SMART
ANK 268 298 1.63e0 SMART
low complexity region 500 515 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Ankrd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ankrd55 APN 13 112367794 missense probably benign 0.01
IGL01372:Ankrd55 APN 13 112323143 missense probably damaging 1.00
IGL01554:Ankrd55 APN 13 112323067 missense possibly damaging 0.87
IGL01700:Ankrd55 APN 13 112381168 missense probably benign 0.16
IGL02366:Ankrd55 APN 13 112318460 missense probably damaging 1.00
IGL03368:Ankrd55 APN 13 112318556 splice site probably benign
crescat UTSW 13 112348863 critical splice donor site probably null
I0000:Ankrd55 UTSW 13 112348725 splice site probably benign
R0547:Ankrd55 UTSW 13 112368223 missense probably benign 0.03
R0781:Ankrd55 UTSW 13 112381233 splice site probably benign
R0981:Ankrd55 UTSW 13 112323076 missense possibly damaging 0.78
R1072:Ankrd55 UTSW 13 112348842 missense possibly damaging 0.83
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R4430:Ankrd55 UTSW 13 112323183 critical splice donor site probably null
R4753:Ankrd55 UTSW 13 112363475 missense probably benign
R4846:Ankrd55 UTSW 13 112363454 missense probably benign 0.00
R4911:Ankrd55 UTSW 13 112323039 splice site probably null
R4996:Ankrd55 UTSW 13 112356088 missense possibly damaging 0.68
R5007:Ankrd55 UTSW 13 112367932 missense probably benign
R5077:Ankrd55 UTSW 13 112355988 missense probably benign 0.19
R5118:Ankrd55 UTSW 13 112355939 missense probably benign 0.00
R5350:Ankrd55 UTSW 13 112336226 missense probably damaging 1.00
R5367:Ankrd55 UTSW 13 112318502 missense probably damaging 1.00
R5560:Ankrd55 UTSW 13 112383490 missense probably benign
R5888:Ankrd55 UTSW 13 112355919 missense possibly damaging 0.62
R6130:Ankrd55 UTSW 13 112318446 missense probably damaging 1.00
R6589:Ankrd55 UTSW 13 112348863 critical splice donor site probably null
R6994:Ankrd55 UTSW 13 112368300 missense probably benign 0.42
R7100:Ankrd55 UTSW 13 112356110 missense probably benign 0.00
R7247:Ankrd55 UTSW 13 112336253 missense probably damaging 0.97
R7340:Ankrd55 UTSW 13 112355963 missense probably damaging 0.99
R7694:Ankrd55 UTSW 13 112367964 missense probably damaging 1.00
R8053:Ankrd55 UTSW 13 112323153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCAGTGCTTGACGAAATC -3'
(R):5'- CCATGAATGGCTTGTAGAATGC -3'

Sequencing Primer
(F):5'- GTGCTTGACGAAATCACAGGATTCTC -3'
(R):5'- GAATGGCTTGTAGAATGCAGCTTAC -3'
Posted On2014-10-02