Incidental Mutation 'R2187:Abcg1'
ID237901
Institutional Source Beutler Lab
Gene Symbol Abcg1
Ensembl Gene ENSMUSG00000024030
Gene NameATP binding cassette subfamily G member 1
SynonymsWhite, Abc8
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #R2187 (G1)
Quality Score206
Status Not validated
Chromosome17
Chromosomal Location31057698-31115777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31105517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 245 (S245R)
Ref Sequence ENSEMBL: ENSMUSP00000024829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024829]
Predicted Effect probably damaging
Transcript: ENSMUST00000024829
AA Change: S245R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024829
Gene: ENSMUSG00000024030
AA Change: S245R

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
AAA 110 293 1.28e-14 SMART
Pfam:ABC2_membrane 391 602 1.4e-48 PFAM
transmembrane domain 636 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The human protein is involved in macrophage cholesterol efflux and may regulate cellular lipid homeostasis in other cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal lipid homeostasis, increased numbers of multiple immune cell types, and abnormal response to a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Foxd4 T G 19: 24,899,855 Q327P probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Abcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Abcg1 APN 17 31105540 missense probably benign 0.11
IGL02496:Abcg1 APN 17 31105604 missense probably damaging 0.98
IGL03264:Abcg1 APN 17 31064454 missense probably benign 0.10
PIT4362001:Abcg1 UTSW 17 31064424 missense possibly damaging 0.81
R0682:Abcg1 UTSW 17 31111251 missense probably benign 0.13
R1036:Abcg1 UTSW 17 31111269 missense probably damaging 1.00
R1109:Abcg1 UTSW 17 31111236 missense probably benign 0.01
R1401:Abcg1 UTSW 17 31114158 missense possibly damaging 0.93
R1500:Abcg1 UTSW 17 31111279 missense probably benign 0.11
R2504:Abcg1 UTSW 17 31092395 missense probably damaging 0.98
R3744:Abcg1 UTSW 17 31111216 splice site probably benign
R4632:Abcg1 UTSW 17 31064473 missense probably benign
R4657:Abcg1 UTSW 17 31108434 missense probably benign 0.13
R4679:Abcg1 UTSW 17 31114261 missense probably benign 0.31
R4845:Abcg1 UTSW 17 31114083 missense possibly damaging 0.94
R5061:Abcg1 UTSW 17 31092392 missense probably damaging 1.00
R5685:Abcg1 UTSW 17 31098286 nonsense probably null
R6743:Abcg1 UTSW 17 31108347 missense possibly damaging 0.92
R7084:Abcg1 UTSW 17 31106131 missense probably benign
R7521:Abcg1 UTSW 17 31064569 missense probably benign 0.15
R7716:Abcg1 UTSW 17 31109519 missense probably benign 0.05
R7866:Abcg1 UTSW 17 31098295 nonsense probably null
R7973:Abcg1 UTSW 17 31104158 missense probably damaging 0.98
R8058:Abcg1 UTSW 17 31105530 missense probably benign
R8087:Abcg1 UTSW 17 31064485 missense probably benign 0.04
Z1177:Abcg1 UTSW 17 31106166 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATATACAGCCCCTGTGGAAG -3'
(R):5'- CCTGTCAGGGATCTTAGGATGG -3'

Sequencing Primer
(F):5'- TGGAAGTGTCACCCTTGAAC -3'
(R):5'- AGTCTGGGGTAAGAATCCTGG -3'
Posted On2014-10-02