Incidental Mutation 'R2187:Foxd4'
ID237907
Institutional Source Beutler Lab
Gene Symbol Foxd4
Ensembl Gene ENSMUSG00000051490
Gene Nameforkhead box D4
SynonymsFkh2, FREAC5
MMRRC Submission 040189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2187 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24898965-24901309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24899855 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 327 (Q327P)
Ref Sequence ENSEMBL: ENSMUSP00000058575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058600]
Predicted Effect probably damaging
Transcript: ENSMUST00000058600
AA Change: Q327P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058575
Gene: ENSMUSG00000051490
AA Change: Q327P

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 86 96 N/A INTRINSIC
FH 101 191 5.83e-57 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
low complexity region 377 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead/winged helix-box (FOX) family of transcription factors. FOX transcription factors play critical roles in the regulation of multiple processes including metabolism, cell proliferation and gene expression during ontogenesis. Mutations in this gene are associated with a complex phenotype consisting of dilated cardiomyopathy, obsessive-compulsive disorders, and suicidality. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A G 3: 92,868,615 S254P probably damaging Het
Abcg1 T A 17: 31,105,517 S245R probably damaging Het
AI597479 T A 1: 43,100,823 W70R probably damaging Het
Ankrd55 A G 13: 112,383,505 S575G probably benign Het
Bfsp2 T A 9: 103,426,777 K343* probably null Het
Cant1 A T 11: 118,408,841 Y227* probably null Het
Cd2bp2 T C 7: 127,194,791 N109D probably benign Het
Chmp6 A G 11: 119,916,736 E135G possibly damaging Het
Dsp T G 13: 38,176,407 S329R probably damaging Het
Epha5 A T 5: 84,086,364 F767L probably damaging Het
Epha7 A T 4: 28,942,648 T566S possibly damaging Het
Erap1 A T 13: 74,662,405 I288F probably damaging Het
Erich6 A G 3: 58,629,845 probably null Het
Fbxo10 A G 4: 45,058,531 V402A probably benign Het
Fndc1 T A 17: 7,741,772 I1604F probably damaging Het
Fxn T A 19: 24,280,489 N26I probably benign Het
Hsf5 G T 11: 87,638,184 G582C possibly damaging Het
Itga8 A G 2: 12,194,420 V522A possibly damaging Het
Lyst C T 13: 13,709,341 T2938I possibly damaging Het
Mib2 T C 4: 155,654,933 E863G possibly damaging Het
Mrgpra9 A G 7: 47,235,049 F290S probably damaging Het
Mst1 T C 9: 108,084,340 Y599H possibly damaging Het
Mylk4 T C 13: 32,722,013 I165V probably damaging Het
Nipsnap2 T C 5: 129,746,473 probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Nup93 T A 8: 94,300,850 S295R probably damaging Het
Nutm2 A T 13: 50,467,417 Q6L probably benign Het
Olfr11 A T 13: 21,639,385 I46N probably damaging Het
Olfr1445 T A 19: 12,884,255 C125S probably damaging Het
Olfr820 A G 10: 130,017,688 E109G probably damaging Het
Olfr988 T G 2: 85,353,915 S4R probably benign Het
Pip5k1a A T 3: 95,071,918 L189Q probably damaging Het
Plekha4 C T 7: 45,549,274 R574C probably damaging Het
Ppp2cb A G 8: 33,610,677 E42G possibly damaging Het
Prkd3 T A 17: 78,975,554 Q244L probably benign Het
Ptpn14 C T 1: 189,863,228 R1023* probably null Het
Ptpra A G 2: 130,504,299 T127A probably benign Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Rasgrf1 T C 9: 89,994,835 I751T possibly damaging Het
Rbm27 A G 18: 42,325,957 K697R probably damaging Het
Rhoa C T 9: 108,335,153 T127M probably benign Het
Rnpepl1 A G 1: 92,916,895 S370G probably null Het
Sdk1 C T 5: 142,114,574 T1453I probably damaging Het
Sel1l2 A G 2: 140,230,873 L614S probably damaging Het
Slc6a20b T A 9: 123,598,588 I419F probably damaging Het
Slc8a1 C T 17: 81,648,553 S352N possibly damaging Het
Spta1 A G 1: 174,192,966 D547G probably damaging Het
Tc2n G A 12: 101,706,544 T46I probably damaging Het
Terb1 T A 8: 104,472,884 Y476F probably benign Het
Trim12a T A 7: 104,304,192 E237D probably damaging Het
Usp47 T C 7: 112,067,191 L309P probably damaging Het
Other mutations in Foxd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02527:Foxd4 APN 19 24899814 missense probably benign
IGL02709:Foxd4 APN 19 24899609 missense probably damaging 0.98
R0544:Foxd4 UTSW 19 24899818 missense possibly damaging 0.95
R1969:Foxd4 UTSW 19 24899814 missense probably benign
R4698:Foxd4 UTSW 19 24900261 missense probably damaging 1.00
R5521:Foxd4 UTSW 19 24899643 missense probably damaging 0.99
R6260:Foxd4 UTSW 19 24899604 missense probably benign 0.02
R6327:Foxd4 UTSW 19 24900834 start codon destroyed possibly damaging 0.89
R6943:Foxd4 UTSW 19 24899876 missense probably damaging 1.00
R7417:Foxd4 UTSW 19 24900462 missense probably damaging 1.00
R7972:Foxd4 UTSW 19 24900230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATTCGGGCAAGGTCCCC -3'
(R):5'- ACATGTTCGACAACGGCAG -3'

Sequencing Primer
(F):5'- TGTCAGCCTACCGTCGTCAG -3'
(R):5'- TTCGACAACGGCAGCTTCC -3'
Posted On2014-10-02