Incidental Mutation 'R0178:9930021J03Rik'
ID23791
Institutional Source Beutler Lab
Gene Symbol 9930021J03Rik
Ensembl Gene ENSMUSG00000046138
Gene NameRIKEN cDNA 9930021J03 gene
SynonymsGm9832
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R0178 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location29714402-29805989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29754788 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 342 (S342P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177155]
Predicted Effect probably damaging
Transcript: ENSMUST00000059484
AA Change: S342P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054060
Gene: ENSMUSG00000046138
AA Change: S342P

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 225 235 N/A INTRINSIC
coiled coil region 248 289 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
low complexity region 495 508 N/A INTRINSIC
coiled coil region 673 705 N/A INTRINSIC
low complexity region 722 756 N/A INTRINSIC
coiled coil region 764 796 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
internal_repeat_1 1164 1293 9.57e-8 PROSPERO
low complexity region 1295 1304 N/A INTRINSIC
low complexity region 1386 1415 N/A INTRINSIC
low complexity region 1468 1483 N/A INTRINSIC
low complexity region 1602 1624 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1732 1745 N/A INTRINSIC
internal_repeat_1 1766 1910 9.57e-8 PROSPERO
low complexity region 1987 1993 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2053 2071 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175726
AA Change: S219P
Predicted Effect probably benign
Transcript: ENSMUST00000175764
SMART Domains Protein: ENSMUSP00000135031
Gene: ENSMUSG00000046138

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 379 393 N/A INTRINSIC
internal_repeat_1 397 526 2.65e-5 PROSPERO
low complexity region 528 537 N/A INTRINSIC
low complexity region 619 648 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 835 857 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 965 978 N/A INTRINSIC
internal_repeat_1 999 1143 2.65e-5 PROSPERO
low complexity region 1220 1226 N/A INTRINSIC
low complexity region 1246 1260 N/A INTRINSIC
low complexity region 1286 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176773
Predicted Effect possibly damaging
Transcript: ENSMUST00000177155
AA Change: S275P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135473
Gene: ENSMUSG00000046138
AA Change: S275P

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 205 219 N/A INTRINSIC
low complexity region 280 298 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
coiled coil region 606 638 N/A INTRINSIC
low complexity region 655 689 N/A INTRINSIC
coiled coil region 697 729 N/A INTRINSIC
low complexity region 1079 1093 N/A INTRINSIC
internal_repeat_1 1097 1226 1.32e-7 PROSPERO
low complexity region 1228 1237 N/A INTRINSIC
low complexity region 1319 1348 N/A INTRINSIC
low complexity region 1401 1416 N/A INTRINSIC
low complexity region 1535 1557 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1665 1678 N/A INTRINSIC
internal_repeat_1 1699 1843 1.32e-7 PROSPERO
low complexity region 1920 1926 N/A INTRINSIC
low complexity region 1946 1960 N/A INTRINSIC
low complexity region 1986 2004 N/A INTRINSIC
Meta Mutation Damage Score 0.2375 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in 9930021J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:9930021J03Rik APN 19 29754020 missense probably benign 0.33
IGL01535:9930021J03Rik APN 19 29753812 missense possibly damaging 0.53
IGL02019:9930021J03Rik APN 19 29717063 missense probably benign 0.28
IGL02034:9930021J03Rik APN 19 29716859 missense possibly damaging 0.73
IGL03114:9930021J03Rik APN 19 29717132 missense probably benign 0.18
IGL03382:9930021J03Rik APN 19 29717276 missense probably damaging 1.00
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0142:9930021J03Rik UTSW 19 29718254 missense possibly damaging 0.93
R0453:9930021J03Rik UTSW 19 29753668 missense probably damaging 1.00
R0730:9930021J03Rik UTSW 19 29717981 missense probably benign 0.00
R0735:9930021J03Rik UTSW 19 29717638 missense possibly damaging 0.92
R0891:9930021J03Rik UTSW 19 29717653 missense probably damaging 1.00
R0894:9930021J03Rik UTSW 19 29720574 splice site probably benign
R1289:9930021J03Rik UTSW 19 29723452 missense probably benign 0.07
R1368:9930021J03Rik UTSW 19 29716396 missense probably damaging 0.97
R1387:9930021J03Rik UTSW 19 29723453 missense probably benign 0.15
R1483:9930021J03Rik UTSW 19 29719345 missense possibly damaging 0.93
R1526:9930021J03Rik UTSW 19 29735145 missense probably damaging 1.00
R1612:9930021J03Rik UTSW 19 29717845 missense possibly damaging 0.86
R1721:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1764:9930021J03Rik UTSW 19 29719160 missense possibly damaging 0.53
R1822:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1824:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1859:9930021J03Rik UTSW 19 29754923 missense possibly damaging 0.53
R1868:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1880:9930021J03Rik UTSW 19 29718123 missense probably benign 0.06
R1898:9930021J03Rik UTSW 19 29735132 missense possibly damaging 0.74
R1936:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1939:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1969:9930021J03Rik UTSW 19 29716675 missense possibly damaging 0.95
R2153:9930021J03Rik UTSW 19 29716829 missense probably benign 0.01
R2366:9930021J03Rik UTSW 19 29753635 missense probably damaging 0.99
R2379:9930021J03Rik UTSW 19 29718875 missense probably benign 0.01
R3107:9930021J03Rik UTSW 19 29723447 missense probably damaging 1.00
R4012:9930021J03Rik UTSW 19 29743590 missense probably damaging 1.00
R4222:9930021J03Rik UTSW 19 29718749 missense probably benign 0.18
R4328:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4329:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4387:9930021J03Rik UTSW 19 29805315 unclassified probably benign
R4688:9930021J03Rik UTSW 19 29717101 missense probably benign 0.33
R4796:9930021J03Rik UTSW 19 29753618 missense probably benign 0.33
R4820:9930021J03Rik UTSW 19 29718409 missense possibly damaging 0.53
R4832:9930021J03Rik UTSW 19 29717216 missense possibly damaging 0.53
R5056:9930021J03Rik UTSW 19 29717359 missense probably benign
R5150:9930021J03Rik UTSW 19 29805550 missense probably damaging 0.96
R5224:9930021J03Rik UTSW 19 29719050 missense possibly damaging 0.73
R5306:9930021J03Rik UTSW 19 29729830 intron probably benign
R5460:9930021J03Rik UTSW 19 29754850 missense probably damaging 0.98
R5477:9930021J03Rik UTSW 19 29754118 missense probably benign 0.33
R5531:9930021J03Rik UTSW 19 29753672 missense possibly damaging 0.73
R5559:9930021J03Rik UTSW 19 29716963 missense possibly damaging 0.91
R5647:9930021J03Rik UTSW 19 29753810 missense possibly damaging 0.73
R5886:9930021J03Rik UTSW 19 29719277 missense probably benign 0.03
R6029:9930021J03Rik UTSW 19 29754967 unclassified probably benign
R6240:9930021J03Rik UTSW 19 29717240 missense probably benign 0.18
R6331:9930021J03Rik UTSW 19 29717747 missense probably benign 0.33
R6456:9930021J03Rik UTSW 19 29716514 missense possibly damaging 0.93
R6584:9930021J03Rik UTSW 19 29718728 missense possibly damaging 0.53
R6661:9930021J03Rik UTSW 19 29723464 missense possibly damaging 0.53
R6991:9930021J03Rik UTSW 19 29719108 missense possibly damaging 0.86
R7059:9930021J03Rik UTSW 19 29719545 missense probably benign 0.33
R7128:9930021J03Rik UTSW 19 29716481 missense possibly damaging 0.53
R7211:9930021J03Rik UTSW 19 29786312 missense
R7471:9930021J03Rik UTSW 19 29729739 splice site probably null
R7686:9930021J03Rik UTSW 19 29717470 missense probably benign 0.34
R8012:9930021J03Rik UTSW 19 29718134 missense possibly damaging 0.73
R8203:9930021J03Rik UTSW 19 29716043 missense probably benign 0.18
RF011:9930021J03Rik UTSW 19 29743609 missense possibly damaging 0.53
X0027:9930021J03Rik UTSW 19 29735199 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATGAATAGGCTGCCCAAGCAC -3'
(R):5'- TGGGAAAGAAAGCTCCTTGCTCAG -3'

Sequencing Primer
(F):5'- AGCAGCCATACTTTCTGGTAG -3'
(R):5'- TTGCTCAGGCAGCTCCAG -3'
Posted On2013-04-16