Incidental Mutation 'R2188:Ssfa2'
ID237911
Institutional Source Beutler Lab
Gene Symbol Ssfa2
Ensembl Gene ENSMUSG00000027007
Gene Namesperm specific antigen 2
SynonymsCS1, CS-1, SPAG13, KRAP
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location79635352-79672966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79644923 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 409 (S409P)
Ref Sequence ENSEMBL: ENSMUSP00000107418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111784] [ENSMUST00000111785] [ENSMUST00000111788]
Predicted Effect probably benign
Transcript: ENSMUST00000111784
AA Change: S409P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107414
Gene: ENSMUSG00000027007
AA Change: S409P

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.5e-88 PFAM
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1144 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111785
AA Change: S409P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107415
Gene: ENSMUSG00000027007
AA Change: S409P

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 861 1029 8.9e-83 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111788
AA Change: S409P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107418
Gene: ENSMUSG00000027007
AA Change: S409P

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
KRAP_IP3R_bind 144 302 6.78e-81 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 423 445 N/A INTRINSIC
low complexity region 743 759 N/A INTRINSIC
Pfam:SSFA2_C 858 1029 7.4e-88 PFAM
low complexity region 1103 1117 N/A INTRINSIC
low complexity region 1166 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133266
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display decreased body weight, resistance to diet induced obesity, increased food intake, decreased adipose tissue mass, elevated metabolic rate, abnormal glucose homeostasis, and abnormal hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Ssfa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ssfa2 APN 2 79657268 missense possibly damaging 0.94
IGL00792:Ssfa2 APN 2 79657463 missense probably benign 0.01
IGL00900:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL00902:Ssfa2 APN 2 79660478 missense probably damaging 1.00
IGL01682:Ssfa2 APN 2 79635637 missense probably damaging 1.00
IGL01683:Ssfa2 APN 2 79670725 intron probably benign
IGL01832:Ssfa2 APN 2 79651418 missense possibly damaging 0.94
IGL02253:Ssfa2 APN 2 79660444 missense probably damaging 1.00
IGL02342:Ssfa2 APN 2 79660285 missense probably benign 0.01
IGL02420:Ssfa2 APN 2 79635642 missense probably damaging 0.99
IGL02445:Ssfa2 APN 2 79657498 missense probably damaging 0.98
IGL02649:Ssfa2 APN 2 79641959 splice site probably benign
IGL03242:Ssfa2 APN 2 79643471 nonsense probably null
IGL03266:Ssfa2 APN 2 79642190 critical splice donor site probably null
IGL03342:Ssfa2 APN 2 79660452 missense probably damaging 1.00
IGL03352:Ssfa2 APN 2 79645101 missense probably damaging 1.00
R0255:Ssfa2 UTSW 2 79660466 missense probably damaging 1.00
R0526:Ssfa2 UTSW 2 79657346 missense probably benign 0.01
R0543:Ssfa2 UTSW 2 79644506 missense possibly damaging 0.79
R1114:Ssfa2 UTSW 2 79657529 missense probably damaging 1.00
R1701:Ssfa2 UTSW 2 79636050 missense probably damaging 1.00
R1734:Ssfa2 UTSW 2 79657822 missense probably damaging 1.00
R1945:Ssfa2 UTSW 2 79662652 missense probably benign 0.03
R2941:Ssfa2 UTSW 2 79635656 missense probably benign 0.19
R4087:Ssfa2 UTSW 2 79658347 nonsense probably null
R4107:Ssfa2 UTSW 2 79644831 missense probably damaging 0.97
R4355:Ssfa2 UTSW 2 79641998 missense probably benign 0.02
R4497:Ssfa2 UTSW 2 79657820 missense probably damaging 1.00
R4615:Ssfa2 UTSW 2 79662382 missense probably damaging 0.99
R4726:Ssfa2 UTSW 2 79662757 missense probably damaging 1.00
R5818:Ssfa2 UTSW 2 79644593 missense probably damaging 1.00
R5889:Ssfa2 UTSW 2 79657728 missense probably damaging 1.00
R6169:Ssfa2 UTSW 2 79645062 missense probably damaging 0.99
R6337:Ssfa2 UTSW 2 79655119 missense probably damaging 1.00
R6677:Ssfa2 UTSW 2 79655101 missense possibly damaging 0.92
R6709:Ssfa2 UTSW 2 79644932 missense probably benign 0.00
R6855:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R6856:Ssfa2 UTSW 2 79657705 missense probably damaging 1.00
R7075:Ssfa2 UTSW 2 79635660 missense probably damaging 0.99
R7319:Ssfa2 UTSW 2 79636072 missense probably damaging 1.00
R7414:Ssfa2 UTSW 2 79644728 missense possibly damaging 0.95
R7590:Ssfa2 UTSW 2 79658110 missense possibly damaging 0.88
R7722:Ssfa2 UTSW 2 79662345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATGCTGGCTACGGTTAC -3'
(R):5'- TCCTGACTATCTACTTACAAAGGAACC -3'

Sequencing Primer
(F):5'- CTGGCTACGGTTACAGAAGAAGTCTC -3'
(R):5'- GCCTACCTCTTCCATCTCAAAGGAG -3'
Posted On2014-10-02