Incidental Mutation 'R2188:Atad3a'
ID237915
Institutional Source Beutler Lab
Gene Symbol Atad3a
Ensembl Gene ENSMUSG00000029036
Gene NameATPase family, AAA domain containing 3A
SynonymsTob3, 2400004H09Rik
MMRRC Submission 040190-MU
Accession Numbers

Genbank: NM_179203; MGI:1919214

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155740641-155761093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155751519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 274 (I274N)
Ref Sequence ENSEMBL: ENSMUSP00000030903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000176043] [ENSMUST00000184913]
Predicted Effect probably damaging
Transcript: ENSMUST00000030903
AA Change: I274N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036
AA Change: I274N

DomainStartEndE-ValueType
Pfam:DUF3523 26 285 9.5e-113 PFAM
AAA 343 482 4.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134317
Predicted Effect unknown
Transcript: ENSMUST00000175679
AA Change: I149N
Predicted Effect probably benign
Transcript: ENSMUST00000176043
SMART Domains Protein: ENSMUSP00000135405
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 20 193 5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177066
Predicted Effect probably benign
Transcript: ENSMUST00000184131
Predicted Effect probably benign
Transcript: ENSMUST00000184913
SMART Domains Protein: ENSMUSP00000138808
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 1 125 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed mitochondrial membrane protein that contributes to mitochondrial dynamics, nucleoid organization, protein translation, cell growth, and cholesterol metabolism. This gene is a member of the ATPase family AAA-domain containing 3 gene family which, in humans, includes two other paralogs. Naturally occurring mutations in this gene are associated with distinct neurological syndromes including Harel-Yoon syndrome. High-level expression of this gene is associated with poor survival in breast cancer patients. A homozygous knockout of the orthologous gene in mice results in embryonic lethality at day 7.5 due to growth retardation and defective development of the trophoblast lineage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele die around E7.5 exhibiting growth retardation, failure to gastrulate, and impaired development of the trophoblast lineage immediately after implantation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Atad3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Atad3a APN 4 155746078 missense probably damaging 0.98
IGL01982:Atad3a APN 4 155753927 missense possibly damaging 0.94
IGL02059:Atad3a APN 4 155754750 splice site probably benign
IGL02572:Atad3a APN 4 155753584 missense possibly damaging 0.61
IGL03086:Atad3a APN 4 155748670 critical splice donor site probably null
IGL03409:Atad3a APN 4 155747350 missense probably damaging 0.99
E2594:Atad3a UTSW 4 155750933 unclassified probably benign
FR4976:Atad3a UTSW 4 155753939 missense probably damaging 0.98
PIT4618001:Atad3a UTSW 4 155750138 missense probably benign 0.41
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0601:Atad3a UTSW 4 155747407 missense probably damaging 1.00
R0799:Atad3a UTSW 4 155747470 missense probably damaging 1.00
R1428:Atad3a UTSW 4 155755682 missense probably damaging 1.00
R1597:Atad3a UTSW 4 155751435 critical splice donor site probably null
R4126:Atad3a UTSW 4 155754061 splice site probably benign
R4564:Atad3a UTSW 4 155747309 splice site probably null
R5334:Atad3a UTSW 4 155755689 missense probably damaging 1.00
R6354:Atad3a UTSW 4 155753945 missense possibly damaging 0.58
R6481:Atad3a UTSW 4 155753641 splice site probably null
R7220:Atad3a UTSW 4 155754041 missense probably benign 0.02
R7689:Atad3a UTSW 4 155756153 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGAGAAAACACCCATGCC -3'
(R):5'- ATAGGGTCAGGCATCCAACCAG -3'

Sequencing Primer
(F):5'- TGCCAGCATGACAGGGAAATC -3'
(R):5'- TCCAACCAGGGTCAGTATAGGC -3'
Posted On2014-10-02