Incidental Mutation 'R2188:Steap2'
ID237916
Institutional Source Beutler Lab
Gene Symbol Steap2
Ensembl Gene ENSMUSG00000015653
Gene Namesix transmembrane epithelial antigen of prostate 2
Synonyms
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5664829-5694578 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 5673643 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 412 (Y412*)
Ref Sequence ENSEMBL: ENSMUSP00000132501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015797] [ENSMUST00000115424] [ENSMUST00000115424] [ENSMUST00000115425] [ENSMUST00000115425] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000148333] [ENSMUST00000148333] [ENSMUST00000164219] [ENSMUST00000164219]
Predicted Effect probably null
Transcript: ENSMUST00000015797
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000015797
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.9e-19 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 405 2.8e-16 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115424
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000111084
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115424
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000111084
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115425
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000111085
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115425
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000111085
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115426
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115427
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148333
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000116910
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.3e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 2.7e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148333
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000116910
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.3e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 2.7e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150238
Predicted Effect probably null
Transcript: ENSMUST00000164219
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164219
AA Change: Y412*
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653
AA Change: Y412*

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the STEAP family and encodes a multi-pass membrane protein that localizes to the Golgi complex, the plasma membrane, and the vesicular tubular structures in the cytosol. A highly similar protein in mouse has both ferrireductase and cupric reductase activity, and stimulates the cellular uptake of both iron and copper in vitro. Increased transcriptional expression of the human gene is associated with prostate cancer progression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Steap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Steap2 APN 5 5673586 missense probably damaging 0.99
IGL02272:Steap2 APN 5 5677612 missense probably benign 0.10
IGL02680:Steap2 APN 5 5673474 missense probably benign 0.00
R0267:Steap2 UTSW 5 5673561 missense probably benign 0.00
R1670:Steap2 UTSW 5 5677393 missense possibly damaging 0.80
R2175:Steap2 UTSW 5 5673501 missense probably damaging 1.00
R2374:Steap2 UTSW 5 5675845 missense probably damaging 0.99
R4902:Steap2 UTSW 5 5675866 missense possibly damaging 0.91
R4941:Steap2 UTSW 5 5677651 missense probably damaging 1.00
R5012:Steap2 UTSW 5 5677784 missense possibly damaging 0.48
R5555:Steap2 UTSW 5 5677544 missense possibly damaging 0.89
R5571:Steap2 UTSW 5 5675912 missense probably damaging 1.00
R5666:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5670:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5677:Steap2 UTSW 5 5677497 nonsense probably null
R6101:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6105:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6190:Steap2 UTSW 5 5675881 missense probably damaging 1.00
R7172:Steap2 UTSW 5 5682896 missense possibly damaging 0.52
R7576:Steap2 UTSW 5 5677406 missense probably benign 0.01
R7706:Steap2 UTSW 5 5682967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCACTGTGACCCTCTCTGG -3'
(R):5'- AACTGCCTTAAATTGCCCAATTCAG -3'

Sequencing Primer
(F):5'- ATGCCTTCGTCTAGAAACTGG -3'
(R):5'- TGCCCAATTCAGAAGACAGTAGTTC -3'
Posted On2014-10-02