Incidental Mutation 'R2188:Hmg20a'
ID237927
Institutional Source Beutler Lab
Gene Symbol Hmg20a
Ensembl Gene ENSMUSG00000032329
Gene Namehigh mobility group 20A
SynonymsHmgxb1, 5730490E10Rik, 1200004E06Rik
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56418609-56496936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56477300 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 118 (E118G)
Ref Sequence ENSEMBL: ENSMUSP00000149359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034879] [ENSMUST00000213242] [ENSMUST00000214771] [ENSMUST00000214869] [ENSMUST00000215269] [ENSMUST00000217518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034879
AA Change: E118G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034879
Gene: ENSMUSG00000032329
AA Change: E118G

DomainStartEndE-ValueType
low complexity region 80 94 N/A INTRINSIC
HMG 101 171 1.86e-21 SMART
coiled coil region 228 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213242
Predicted Effect possibly damaging
Transcript: ENSMUST00000214771
AA Change: E118G

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000214869
Predicted Effect possibly damaging
Transcript: ENSMUST00000215269
AA Change: E118G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217518
AA Change: E118G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Hmg20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Hmg20a APN 9 56487650 missense probably damaging 1.00
IGL01981:Hmg20a APN 9 56477230 missense probably damaging 1.00
IGL02085:Hmg20a APN 9 56477302 nonsense probably null
IGL03284:Hmg20a APN 9 56481617 missense probably benign 0.25
ANU22:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
P0033:Hmg20a UTSW 9 56489824 missense probably benign 0.01
R0369:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
R0710:Hmg20a UTSW 9 56474670 missense possibly damaging 0.84
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1546:Hmg20a UTSW 9 56467401 missense possibly damaging 0.56
R4730:Hmg20a UTSW 9 56467419 missense possibly damaging 0.85
R4956:Hmg20a UTSW 9 56481664 missense probably damaging 1.00
R6115:Hmg20a UTSW 9 56489832 missense possibly damaging 0.95
R6130:Hmg20a UTSW 9 56488607 splice site probably null
R6152:Hmg20a UTSW 9 56481608 missense probably damaging 1.00
R6961:Hmg20a UTSW 9 56488728 missense probably benign 0.29
R7499:Hmg20a UTSW 9 56488943 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCTCGTGTCCTATTTGACG -3'
(R):5'- GATCTGCTATGTGCTACCACC -3'

Sequencing Primer
(F):5'- TGTTACTATTGCTGATGACTTACTTG -3'
(R):5'- CTCAAATCCTCTGGAGTAGCAGTG -3'
Posted On2014-10-02