Incidental Mutation 'R0180:Efhc1'
ID23793
Institutional Source Beutler Lab
Gene Symbol Efhc1
Ensembl Gene ENSMUSG00000041809
Gene NameEF-hand domain (C-terminal) containing 1
SynonymsmRib72-1, myoclonin1, 1700029F22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location20951626-20990841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20967489 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 297 (M297V)
Ref Sequence ENSEMBL: ENSMUSP00000042343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038447]
Predicted Effect probably benign
Transcript: ENSMUST00000038447
AA Change: M297V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809
AA Change: M297V

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display myoclonus and increased susceptibility to pharmacologically induced seizures. Homozygous mice also display enlarged brain ventricles and reduced hippocampal size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Efhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Efhc1 APN 1 20979481 nonsense probably null
IGL00549:Efhc1 APN 1 20979481 nonsense probably null
IGL01611:Efhc1 APN 1 20990687 makesense probably null
IGL01916:Efhc1 APN 1 20978749 missense probably damaging 1.00
IGL02366:Efhc1 APN 1 20960262 missense probably damaging 0.99
IGL02567:Efhc1 APN 1 20972964 missense probably damaging 0.98
IGL02590:Efhc1 APN 1 20967384 missense probably damaging 1.00
IGL02869:Efhc1 APN 1 20967343 missense probably damaging 0.96
IGL03264:Efhc1 APN 1 20967491 missense probably benign
IGL03292:Efhc1 APN 1 20960272 missense possibly damaging 0.89
IGL03097:Efhc1 UTSW 1 20972825 missense probably damaging 1.00
P0023:Efhc1 UTSW 1 20955527 missense probably benign
R0220:Efhc1 UTSW 1 20967358 missense probably damaging 0.98
R0391:Efhc1 UTSW 1 20960188 missense probably damaging 1.00
R0765:Efhc1 UTSW 1 20978652 missense probably benign 0.00
R1293:Efhc1 UTSW 1 20978772 missense probably damaging 0.96
R1414:Efhc1 UTSW 1 20961289 missense probably damaging 1.00
R1644:Efhc1 UTSW 1 20967401 nonsense probably null
R1799:Efhc1 UTSW 1 20979538 missense probably benign 0.00
R1932:Efhc1 UTSW 1 20967400 missense probably damaging 1.00
R1991:Efhc1 UTSW 1 20989560 nonsense probably null
R2103:Efhc1 UTSW 1 20989560 nonsense probably null
R3956:Efhc1 UTSW 1 20978666 missense probably damaging 0.96
R4812:Efhc1 UTSW 1 20990647 missense probably damaging 0.99
R5064:Efhc1 UTSW 1 20974963 missense possibly damaging 0.91
R5562:Efhc1 UTSW 1 20972880 missense probably damaging 0.98
R5800:Efhc1 UTSW 1 20978781 missense probably benign 0.00
R5948:Efhc1 UTSW 1 20972828 missense probably damaging 0.99
R5977:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R6313:Efhc1 UTSW 1 20979428 missense possibly damaging 0.69
R6375:Efhc1 UTSW 1 20972940 missense probably benign 0.05
R6512:Efhc1 UTSW 1 20960349 missense probably damaging 0.99
R6530:Efhc1 UTSW 1 20961142 splice site probably null
R6865:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R7398:Efhc1 UTSW 1 20989520 missense probably benign
R7656:Efhc1 UTSW 1 20961057 intron probably null
R7676:Efhc1 UTSW 1 20967369 missense probably damaging 1.00
R7719:Efhc1 UTSW 1 20979520 missense probably benign
R7775:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7778:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7824:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7857:Efhc1 UTSW 1 20975002 missense probably benign 0.11
R7940:Efhc1 UTSW 1 20975002 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GATTCTATGCCATCTGGGACGACAC -3'
(R):5'- CAGGTTCAGTCTAGAAGCCTTGCTC -3'

Sequencing Primer
(F):5'- ACACGGATAGCTTGTTCGG -3'
(R):5'- GTCAAACCATCTCTACTGGTGTATG -3'
Posted On2013-04-16