Incidental Mutation 'R2188:Ccdc12'
ID237930
Institutional Source Beutler Lab
Gene Symbol Ccdc12
Ensembl Gene ENSMUSG00000019659
Gene Namecoiled-coil domain containing 12
Synonyms
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110656503-110711606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110656631 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 23 (K23N)
Ref Sequence ENSEMBL: ENSMUSP00000142985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019803] [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196347] [ENSMUST00000196488]
Predicted Effect probably benign
Transcript: ENSMUST00000019803
AA Change: K23N

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019803
Gene: ENSMUSG00000019659
AA Change: K23N

DomainStartEndE-ValueType
Pfam:cwf18 10 143 2.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133191
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167320
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196092
Predicted Effect possibly damaging
Transcript: ENSMUST00000196347
AA Change: K23N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142985
Gene: ENSMUSG00000019659
AA Change: K23N

DomainStartEndE-ValueType
Pfam:cwf18 9 142 1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196488
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199687
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Ccdc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02525:Ccdc12 APN 9 110711101 missense probably damaging 1.00
R0003:Ccdc12 UTSW 9 110656597 missense possibly damaging 0.83
R1462:Ccdc12 UTSW 9 110656594 missense probably damaging 1.00
R1462:Ccdc12 UTSW 9 110656594 missense probably damaging 1.00
R6670:Ccdc12 UTSW 9 110708527 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCGTGGACTTTTGTATCAACTC -3'
(R):5'- GAAACGAGCCTATCTCAGAGG -3'

Sequencing Primer
(F):5'- CAACTCAGCATTGATTGGTTCTCAG -3'
(R):5'- AGCCTATCTCAGAGGTCAGC -3'
Posted On2014-10-02