Incidental Mutation 'R2188:Slc2a12'
ID237931
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22664837 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 197 (S197F)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
AA Change: S197F

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: S197F

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159174
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
R7592:Slc2a12 UTSW 10 22664903 missense probably damaging 1.00
R7641:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
R7674:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGCTCCTTATAATGGGGAG -3'
(R):5'- TCCTTAGAGCGAAACAGATCCC -3'

Sequencing Primer
(F):5'- CTCCTTATAATGGGGAGAGTGGC -3'
(R):5'- GATCAAAGTGAGTTCTTCAGTGG -3'
Posted On2014-10-02