Incidental Mutation 'R2188:Gm5134'
ID237932
Institutional Source Beutler Lab
Gene Symbol Gm5134
Ensembl Gene ENSMUSG00000033255
Gene Namepredicted gene 5134
Synonyms
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75954514-76009591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75995836 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 370 (S370P)
Ref Sequence ENSEMBL: ENSMUSP00000097172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099577]
Predicted Effect probably damaging
Transcript: ENSMUST00000099577
AA Change: S370P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097172
Gene: ENSMUSG00000033255
AA Change: S370P

DomainStartEndE-ValueType
Pfam:SSF 32 466 2.9e-119 PFAM
transmembrane domain 500 522 N/A INTRINSIC
transmembrane domain 651 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134234
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Gm5134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gm5134 APN 10 76000421 missense possibly damaging 0.70
IGL01371:Gm5134 APN 10 76004747 missense probably damaging 0.99
IGL02140:Gm5134 APN 10 75986111 missense probably benign 0.03
IGL02197:Gm5134 APN 10 75954702 critical splice donor site probably null
IGL02233:Gm5134 APN 10 76008500 critical splice acceptor site probably null
IGL02612:Gm5134 APN 10 75992489 missense probably damaging 1.00
IGL02896:Gm5134 APN 10 75974224 missense possibly damaging 0.82
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0110:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R0499:Gm5134 UTSW 10 75992525 missense probably benign 0.00
R0510:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R1429:Gm5134 UTSW 10 75978381 missense probably damaging 1.00
R1726:Gm5134 UTSW 10 75992527 missense possibly damaging 0.83
R1918:Gm5134 UTSW 10 75976346 missense possibly damaging 0.70
R1956:Gm5134 UTSW 10 76004846 missense possibly damaging 0.89
R1993:Gm5134 UTSW 10 75966393 missense probably damaging 0.96
R2049:Gm5134 UTSW 10 76004884 missense possibly damaging 0.92
R3551:Gm5134 UTSW 10 76000447 missense probably benign 0.08
R4074:Gm5134 UTSW 10 76008531 missense probably damaging 1.00
R4435:Gm5134 UTSW 10 75995824 missense probably damaging 1.00
R4466:Gm5134 UTSW 10 76008575 missense probably benign 0.00
R5180:Gm5134 UTSW 10 75976366 missense probably damaging 1.00
R5446:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R5601:Gm5134 UTSW 10 75985952 missense probably damaging 0.98
R5627:Gm5134 UTSW 10 75986108 missense possibly damaging 0.93
R5777:Gm5134 UTSW 10 76004760 missense probably benign 0.00
R5867:Gm5134 UTSW 10 76008616 missense probably benign 0.00
R6145:Gm5134 UTSW 10 75995839 missense probably damaging 0.99
R6232:Gm5134 UTSW 10 75986025 missense possibly damaging 0.95
R6271:Gm5134 UTSW 10 75995809 missense probably benign 0.32
R6329:Gm5134 UTSW 10 75954660 missense possibly damaging 0.68
R6723:Gm5134 UTSW 10 76008619 missense probably benign
R7049:Gm5134 UTSW 10 75992458 missense probably damaging 0.97
R7305:Gm5134 UTSW 10 76000399 missense probably damaging 1.00
R7579:Gm5134 UTSW 10 75964437 missense probably damaging 1.00
X0050:Gm5134 UTSW 10 75992510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATTCCACTCCAGGTTTG -3'
(R):5'- GCGCCTTACATTATCATCGC -3'

Sequencing Primer
(F):5'- ACTCCAGGTTTGTCCAGGCTG -3'
(R):5'- GCCTTACATTATCATCGCAAAACTTC -3'
Posted On2014-10-02