Incidental Mutation 'R2188:Snapc1'
ID237938
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73970227 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 213 (I213N)
Ref Sequence ENSEMBL: ENSMUSP00000021532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556] [ENSMUST00000222025]
Predicted Effect probably damaging
Transcript: ENSMUST00000021532
AA Change: I213N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: I213N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220882
Predicted Effect probably benign
Transcript: ENSMUST00000220909
Predicted Effect probably benign
Transcript: ENSMUST00000221556
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Predicted Effect probably benign
Transcript: ENSMUST00000222025
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0056:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0152:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4165:Snapc1 UTSW 12 73982580 critical splice donor site probably null
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4549:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCTACACTTCCAACCAGCCTGG -3'
(R):5'- GGTAACGCCCTCTGAATCTTG -3'

Sequencing Primer
(F):5'- TGGGCCACATACGAAGACACTG -3'
(R):5'- AGCAATGTGGCCTCTCTACAG -3'
Posted On2014-10-02