Incidental Mutation 'R2188:Tekt5'
ID237948
Institutional Source Beutler Lab
Gene Symbol Tekt5
Ensembl Gene ENSMUSG00000039179
Gene Nametektin 5
Synonyms
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2188 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location10357948-10395490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10358325 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 452 (E452G)
Ref Sequence ENSEMBL: ENSMUSP00000046824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043415] [ENSMUST00000115831]
Predicted Effect probably damaging
Transcript: ENSMUST00000043415
AA Change: E452G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046824
Gene: ENSMUSG00000039179
AA Change: E452G

DomainStartEndE-ValueType
Pfam:Tektin 95 477 3.9e-136 PFAM
low complexity region 515 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115831
SMART Domains Protein: ENSMUSP00000111497
Gene: ENSMUSG00000039179

DomainStartEndE-ValueType
Pfam:Tektin 95 415 8.3e-111 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Srpk1 A T 17: 28,594,189 I527N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Tekt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02266:Tekt5 APN 16 10379042 missense probably benign 0.04
IGL02396:Tekt5 APN 16 10379067 missense probably benign 0.00
R0609:Tekt5 UTSW 16 10361304 missense possibly damaging 0.62
R2004:Tekt5 UTSW 16 10395206 missense probably benign
R2006:Tekt5 UTSW 16 10395206 missense probably benign
R4510:Tekt5 UTSW 16 10358013 missense probably benign 0.06
R4511:Tekt5 UTSW 16 10358013 missense probably benign 0.06
R4745:Tekt5 UTSW 16 10395194 missense probably damaging 1.00
R4814:Tekt5 UTSW 16 10382907 missense probably damaging 1.00
R5331:Tekt5 UTSW 16 10361329 missense probably benign
R5546:Tekt5 UTSW 16 10361390 missense possibly damaging 0.69
R5910:Tekt5 UTSW 16 10387153 critical splice donor site probably null
R6909:Tekt5 UTSW 16 10358301 missense probably damaging 1.00
R7822:Tekt5 UTSW 16 10382928 missense possibly damaging 0.90
R7823:Tekt5 UTSW 16 10386079 missense probably damaging 0.96
R8046:Tekt5 UTSW 16 10395413 missense not run
X0019:Tekt5 UTSW 16 10386084 missense probably benign 0.31
Z1088:Tekt5 UTSW 16 10358377 missense probably damaging 1.00
Z1176:Tekt5 UTSW 16 10358221 missense not run
Predicted Primers PCR Primer
(F):5'- CGTTATGCCATTTAACACACCGG -3'
(R):5'- TCATACAGGGGTGTCTGTGC -3'

Sequencing Primer
(F):5'- GCCTTTACAAAGCGCTGAG -3'
(R):5'- CTAAAGGAGAGTCATGGAGGTTTCTC -3'
Posted On2014-10-02