Incidental Mutation 'R2188:Srpk1'
ID237949
Institutional Source Beutler Lab
Gene Symbol Srpk1
Ensembl Gene ENSMUSG00000004865
Gene Nameserine/arginine-rich protein specific kinase 1
SynonymsSR protein-specific kinase 1
MMRRC Submission 040190-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R2188 (G1)
Quality Score171
Status Not validated
Chromosome17
Chromosomal Location28587648-28622521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28594189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 527 (I527N)
Ref Sequence ENSEMBL: ENSMUSP00000116259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004987] [ENSMUST00000130643]
Predicted Effect probably benign
Transcript: ENSMUST00000004987
SMART Domains Protein: ENSMUSP00000004987
Gene: ENSMUSG00000004865

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 158 1.8e-12 PFAM
Pfam:Pkinase 8 160 1.5e-25 PFAM
low complexity region 169 183 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126683
Predicted Effect probably damaging
Transcript: ENSMUST00000130643
AA Change: I527N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865
AA Change: I527N

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,002,533 L547P probably damaging Het
Arhgap29 A C 3: 121,991,009 D195A probably damaging Het
Atad3a A T 4: 155,751,519 I274N probably damaging Het
C130060K24Rik C A 6: 65,441,276 H143N probably damaging Het
Ccdc12 G T 9: 110,656,631 K23N possibly damaging Het
Ccpg1 A G 9: 73,013,106 T668A probably benign Het
Cdc34b T C 11: 94,742,172 I66T probably benign Het
Dnah1 A G 14: 31,279,164 I2408T probably damaging Het
Fam91a1 A C 15: 58,430,663 N284T probably damaging Het
Gbp2b A T 3: 142,608,279 E440V probably benign Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Hmcn2 G A 2: 31,419,935 A3238T probably benign Het
Hmg20a A G 9: 56,477,300 E118G possibly damaging Het
Kdm5a T A 6: 120,406,640 F781I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2d A G 15: 98,839,300 probably benign Het
Lrp1b T C 2: 41,408,959 T857A probably benign Het
Mucl2 T A 15: 103,897,574 N39I probably damaging Het
Myl6 A G 10: 128,492,697 I27T possibly damaging Het
Ndor1 A T 2: 25,251,753 probably null Het
Nlrp9a A G 7: 26,564,929 E758G probably damaging Het
Olfr52 A T 2: 86,181,436 I225N probably damaging Het
Olfr652 G A 7: 104,564,676 A152T probably benign Het
Parp3 G A 9: 106,475,852 R42W probably damaging Het
Pik3c2g A G 6: 139,852,874 I495V probably damaging Het
Sdsl C T 5: 120,458,420 G310S probably damaging Het
Sec24a A G 11: 51,723,584 L531P probably damaging Het
Slc2a12 C T 10: 22,664,837 S197F probably benign Het
Snapc1 T A 12: 73,970,227 I213N probably damaging Het
Ssfa2 T C 2: 79,644,923 S409P probably benign Het
Steap2 G T 5: 5,673,643 Y412* probably null Het
Tbk1 A C 10: 121,563,931 Y329* probably null Het
Tekt5 T C 16: 10,358,325 E452G probably damaging Het
Tmc5 G T 7: 118,654,955 C672F probably damaging Het
Trim27 T C 13: 21,183,817 L201S probably damaging Het
Vil1 A C 1: 74,427,565 D638A probably benign Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfp583 C T 7: 6,317,611 R134H probably benign Het
Other mutations in Srpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Srpk1 APN 17 28606317 missense probably damaging 1.00
IGL01792:Srpk1 APN 17 28599467 splice site probably benign
IGL03153:Srpk1 APN 17 28592266 missense possibly damaging 0.57
H8562:Srpk1 UTSW 17 28602733 missense probably benign 0.32
R0481:Srpk1 UTSW 17 28590244 splice site probably benign
R1160:Srpk1 UTSW 17 28599774 missense probably benign 0.05
R4640:Srpk1 UTSW 17 28608724 missense probably benign
R4716:Srpk1 UTSW 17 28622008 missense probably benign 0.16
R4880:Srpk1 UTSW 17 28591225 missense probably damaging 0.98
R5458:Srpk1 UTSW 17 28599472 splice site probably null
R5533:Srpk1 UTSW 17 28602759 missense probably damaging 1.00
R6383:Srpk1 UTSW 17 28590062 missense probably damaging 1.00
R6766:Srpk1 UTSW 17 28602753 missense possibly damaging 0.85
R7483:Srpk1 UTSW 17 28594218 missense probably benign 0.11
X0058:Srpk1 UTSW 17 28602835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAAGGCTATAAGCTCAAGG -3'
(R):5'- GCAGACAGCTTGCTTTAGTTTC -3'

Sequencing Primer
(F):5'- CCAATACAGGAAAAAGAATGCCTTTG -3'
(R):5'- AGACAGCTTGCTTTAGTTTCCATCG -3'
Posted On2014-10-02