Incidental Mutation 'R2189:Adamtsl2'
ID237952
Institutional Source Beutler Lab
Gene Symbol Adamtsl2
Ensembl Gene ENSMUSG00000036040
Gene NameADAMTS-like 2
SynonymsA930008K15Rik
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27079379-27108981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27081738 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 12 (W12R)
Ref Sequence ENSEMBL: ENSMUSP00000088774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233]
Predicted Effect probably benign
Transcript: ENSMUST00000091233
AA Change: W12R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: W12R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Adamtsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Adamtsl2 APN 2 27085088 missense probably damaging 1.00
IGL01902:Adamtsl2 APN 2 27087252 missense probably damaging 1.00
IGL02207:Adamtsl2 APN 2 27102981 missense probably damaging 0.99
IGL02247:Adamtsl2 APN 2 27084893 missense probably damaging 1.00
IGL02253:Adamtsl2 APN 2 27098697 missense possibly damaging 0.48
IGL02655:Adamtsl2 APN 2 27082530 splice site probably benign
IGL03148:Adamtsl2 APN 2 27084059 missense probably damaging 0.99
IGL03269:Adamtsl2 APN 2 27108355 nonsense probably null
R0609:Adamtsl2 UTSW 2 27089635 missense probably benign 0.25
R1183:Adamtsl2 UTSW 2 27084080 missense probably damaging 1.00
R1443:Adamtsl2 UTSW 2 27103066 missense possibly damaging 0.89
R1675:Adamtsl2 UTSW 2 27082485 frame shift probably null
R1698:Adamtsl2 UTSW 2 27103127 missense possibly damaging 0.92
R1765:Adamtsl2 UTSW 2 27102830 missense probably benign 0.01
R1934:Adamtsl2 UTSW 2 27089593 missense probably damaging 0.99
R2106:Adamtsl2 UTSW 2 27102825 missense probably benign 0.02
R2108:Adamtsl2 UTSW 2 27095558 missense probably benign
R2232:Adamtsl2 UTSW 2 27103178 missense probably damaging 1.00
R4301:Adamtsl2 UTSW 2 27087283 missense probably null 1.00
R4518:Adamtsl2 UTSW 2 27095547 missense probably benign 0.00
R4572:Adamtsl2 UTSW 2 27083256 missense probably damaging 0.99
R4627:Adamtsl2 UTSW 2 27093585 missense probably damaging 0.99
R4668:Adamtsl2 UTSW 2 27095475 missense probably benign 0.00
R4686:Adamtsl2 UTSW 2 27093825 missense probably damaging 0.99
R4821:Adamtsl2 UTSW 2 27098592 splice site probably null
R5054:Adamtsl2 UTSW 2 27101720 missense probably damaging 1.00
R5460:Adamtsl2 UTSW 2 27095398 splice site probably null
R5569:Adamtsl2 UTSW 2 27102833 missense probably damaging 1.00
R5694:Adamtsl2 UTSW 2 27081724 missense probably benign 0.03
R6836:Adamtsl2 UTSW 2 27081706 start codon destroyed probably null 0.90
R7103:Adamtsl2 UTSW 2 27107461 missense probably damaging 1.00
R7437:Adamtsl2 UTSW 2 27089709 missense probably damaging 0.99
X0003:Adamtsl2 UTSW 2 27081772 small deletion probably benign
X0003:Adamtsl2 UTSW 2 27081773 small deletion probably benign
Z1176:Adamtsl2 UTSW 2 27081720 missense not run
Predicted Primers PCR Primer
(F):5'- AATTACTTACCAAGCTGCTTGC -3'
(R):5'- TCAATACCCCTGGGCATGAC -3'

Sequencing Primer
(F):5'- CTTGCTGAGCCCAGATGGATG -3'
(R):5'- GGCATACTACTCACGGAAG -3'
Posted On2014-10-02