Incidental Mutation 'R2189:Mmadhc'
ID237953
Institutional Source Beutler Lab
Gene Symbol Mmadhc
Ensembl Gene ENSMUSG00000026766
Gene Namemethylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Synonyms2010311D03Rik
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location50279881-50296801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50288946 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 153 (C153W)
Ref Sequence ENSEMBL: ENSMUSP00000122804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102769] [ENSMUST00000133768] [ENSMUST00000144143]
Predicted Effect probably damaging
Transcript: ENSMUST00000102769
AA Change: C153W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099830
Gene: ENSMUSG00000026766
AA Change: C153W

DomainStartEndE-ValueType
Pfam:DUF2246 24 294 8.5e-134 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133768
AA Change: C153W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115961
Gene: ENSMUSG00000026766
AA Change: C153W

DomainStartEndE-ValueType
Pfam:DUF2246 20 179 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140563
Predicted Effect probably damaging
Transcript: ENSMUST00000144143
AA Change: C153W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122804
Gene: ENSMUSG00000026766
AA Change: C153W

DomainStartEndE-ValueType
Pfam:DUF2246 20 219 1.5e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154254
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is involved in an early step of vitamin B12 metabolism. Vitamin B12 (cobalamin) is essential for normal development and survival in humans. Mutations in this gene cause methylmalonic aciduria and homocystinuria type cblD (MMADHC), a disorder of cobalamin metabolism that is characterized by decreased levels of the coenzymes adenosylcobalamin and methylcobalamin. Pseudogenes have been identified on chromosomes 11 and X.[provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Mmadhc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Mmadhc APN 2 50289031 missense probably benign
IGL01732:Mmadhc APN 2 50281185 missense probably damaging 1.00
IGL02397:Mmadhc APN 2 50288980 missense possibly damaging 0.82
R0091:Mmadhc UTSW 2 50292857 missense probably damaging 1.00
R0458:Mmadhc UTSW 2 50281161 missense probably benign 0.01
R0573:Mmadhc UTSW 2 50292835 missense possibly damaging 0.79
R1613:Mmadhc UTSW 2 50280326 missense probably damaging 1.00
R4092:Mmadhc UTSW 2 50287883 missense probably benign
R4214:Mmadhc UTSW 2 50291332 missense probably benign
R4498:Mmadhc UTSW 2 50280224 missense probably benign 0.25
R5355:Mmadhc UTSW 2 50291424 missense probably benign 0.18
R5961:Mmadhc UTSW 2 50291409 missense probably damaging 1.00
R7343:Mmadhc UTSW 2 50291445 missense probably damaging 1.00
X0018:Mmadhc UTSW 2 50287917 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTTGTGAAAGCTCAAGCAATC -3'
(R):5'- AACTTTGTCAGACTTCAAGACCTG -3'

Sequencing Primer
(F):5'- GCTCAAGCAATCATTTCTATCCAG -3'
(R):5'- GTTGGCTATAGCACTTTGAGAC -3'
Posted On2014-10-02