Incidental Mutation 'R2189:Vmn2r5'
ID237958
Institutional Source Beutler Lab
Gene Symbol Vmn2r5
Ensembl Gene ENSMUSG00000068999
Gene Namevomeronasal 2, receptor 5
SynonymsEG667060
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location64490821-64509735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64509593 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 48 (M48R)
Ref Sequence ENSEMBL: ENSMUSP00000135592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]
Predicted Effect probably benign
Transcript: ENSMUST00000170270
SMART Domains Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 9.9e-78 PFAM
Pfam:NCD3G 458 511 8.5e-18 PFAM
Pfam:7tm_3 542 779 2.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177184
AA Change: M48R

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: M48R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 86 503 1.8e-80 PFAM
Pfam:NCD3G 545 598 1e-14 PFAM
Pfam:7tm_3 631 865 1.4e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Vmn2r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Vmn2r5 APN 3 64491413 missense possibly damaging 0.67
IGL01139:Vmn2r5 APN 3 64491405 missense probably benign 0.28
IGL03293:Vmn2r5 APN 3 64491326 missense probably benign 0.01
PIT4581001:Vmn2r5 UTSW 3 64503927 nonsense probably null
R0063:Vmn2r5 UTSW 3 64503800 missense probably benign 0.01
R0142:Vmn2r5 UTSW 3 64492588 missense probably damaging 1.00
R0193:Vmn2r5 UTSW 3 64491530 missense possibly damaging 0.91
R0219:Vmn2r5 UTSW 3 64504313 missense probably damaging 0.99
R0313:Vmn2r5 UTSW 3 64503827 missense probably benign
R0620:Vmn2r5 UTSW 3 64503814 nonsense probably null
R0726:Vmn2r5 UTSW 3 64503765 missense probably benign 0.01
R1073:Vmn2r5 UTSW 3 64491305 nonsense probably null
R1549:Vmn2r5 UTSW 3 64504000 missense probably damaging 1.00
R1581:Vmn2r5 UTSW 3 64491219 missense probably damaging 1.00
R1624:Vmn2r5 UTSW 3 64509695 missense probably benign 0.19
R1973:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1974:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1975:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1977:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R2484:Vmn2r5 UTSW 3 64503971 missense possibly damaging 0.94
R4573:Vmn2r5 UTSW 3 64503918 missense probably damaging 0.98
R5243:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5384:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5385:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5587:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5588:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5589:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5590:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5739:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R6113:Vmn2r5 UTSW 3 64491399 missense probably benign 0.03
R6739:Vmn2r5 UTSW 3 64491216 missense probably damaging 0.97
R7106:Vmn2r5 UTSW 3 64491683 missense probably benign 0.05
R7304:Vmn2r5 UTSW 3 64504250 missense probably damaging 0.97
R7402:Vmn2r5 UTSW 3 64495755 missense probably benign 0.05
R7477:Vmn2r5 UTSW 3 64491639 missense probably damaging 1.00
R7571:Vmn2r5 UTSW 3 64504404 missense probably damaging 1.00
R7678:Vmn2r5 UTSW 3 64509522 missense probably benign
R7874:Vmn2r5 UTSW 3 64491032 missense probably damaging 1.00
R8110:Vmn2r5 UTSW 3 64491288 missense probably benign 0.00
R8223:Vmn2r5 UTSW 3 64491305 nonsense probably null
R8767:Vmn2r5 UTSW 3 64507682 missense possibly damaging 0.79
Z1088:Vmn2r5 UTSW 3 64509542 missense probably benign 0.02
Z1177:Vmn2r5 UTSW 3 64491051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATACAGGTCCCATGATAACC -3'
(R):5'- CACTTCTACACTCCATCAAGGTG -3'

Sequencing Primer
(F):5'- ATGATAACCAGTCCTTTCAGGC -3'
(R):5'- AGGTGCTTCCTTCAAACCTGTG -3'
Posted On2014-10-02