Mutagenetix > Incidental Mutation

Incidental Mutation 'R2189:Vmn2r5'

237958

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r5

Ensembl Gene

ENSMUSG00000068999

Gene Name

vomeronasal 2, receptor 5

Synonyms

EG667060

MMRRC Submission

040191-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R2189 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64490821-64509735 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 64509593 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 48 (M48R)

Ref Sequence

ENSEMBL: ENSMUSP00000135592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]

AlphaFold

K7N788

Predicted Effect

probably benign
Transcript: ENSMUST00000170270

SMART Domains

Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	416	9.9e-78	PFAM
Pfam:NCD3G	458	511	8.5e-18	PFAM
Pfam:7tm_3	542	779	2.3e-74	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177184
AA Change: M48R

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: M48R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	86	503	1.8e-80	PFAM
Pfam:NCD3G	545	598	1e-14	PFAM
Pfam:7tm_3	631	865	1.4e-45	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	C	7: 79,098,091	G870A	probably damaging	Het
Adamtsl2	T	C	2: 27,081,738	W12R	probably benign	Het
Bsph1	G	A	7: 13,470,329		probably null	Het
Celsr1	G	T	15: 85,979,230	H1200Q	possibly damaging	Het
Clptm1	A	T	7: 19,637,145	Y355*	probably null	Het
Cry2	T	C	2: 92,411,692	E572G	possibly damaging	Het
Dlk1	G	A	12: 109,455,049		probably null	Het
Eral1	A	G	11: 78,075,831	V201A	probably benign	Het
Esrp1	A	T	4: 11,357,603	M503K	probably benign	Het
Fam83e	G	T	7: 45,722,183	M1I	probably null	Het
Flt4	G	A	11: 49,635,698	A835T	probably benign	Het
Hdac4	T	C	1: 91,975,522	S562G	probably null	Het
Hist1h2bn	A	G	13: 21,754,277	D52G	probably damaging	Het
Icosl	A	G	10: 78,073,925	T235A	possibly damaging	Het
Itga6	A	G	2: 71,825,617	D295G	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lipa	A	T	19: 34,524,799	L15Q	probably benign	Het
Mcc	T	C	18: 44,534,230	E218G	possibly damaging	Het
Mdga2	A	G	12: 66,473,196		probably null	Het
Mmadhc	A	C	2: 50,288,946	C153W	probably damaging	Het
Myh1	A	G	11: 67,221,604	D1799G	probably damaging	Het
Nlrp1b	T	A	11: 71,169,795	Q729L	probably damaging	Het
Ofcc1	T	A	13: 40,180,448	Q389L	probably benign	Het
Olfr1030	A	G	2: 85,984,068	D76G	probably damaging	Het
Olfr469	T	C	7: 107,822,615	I285V	probably benign	Het
Olfr481	A	T	7: 108,081,036	M81L	possibly damaging	Het
Olfr691	A	G	7: 105,337,602	V38A	probably benign	Het
Pml	T	C	9: 58,234,874	N225S	probably benign	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Scap	T	A	9: 110,377,693	I402N	probably damaging	Het
Sgsm2	A	G	11: 74,853,082	L886P	probably damaging	Het
Sugct	T	C	13: 17,662,266	I104V	probably benign	Het
Tmem200c	A	G	17: 68,840,686	Q88R	probably damaging	Het
Tnfrsf1a	T	A	6: 125,357,805	L14Q	probably benign	Het
Tnk2	C	T	16: 32,671,421	L381F	probably damaging	Het
Ubr2	C	T	17: 46,943,364	V1454I	probably benign	Het
V1ra8	A	C	6: 90,202,962	D49A	probably damaging	Het
Yars	A	G	4: 129,206,189	I227V	probably damaging	Het
Zfp850	C	A	7: 27,989,055	R576L	probably benign	Het
Zfpm2	T	A	15: 41,101,183	F223I	possibly damaging	Het

Other mutations in Vmn2r5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Vmn2r5	APN	3	64491413	missense	possibly damaging	0.67
IGL01139:Vmn2r5	APN	3	64491405	missense	probably benign	0.28
IGL03293:Vmn2r5	APN	3	64491326	missense	probably benign	0.01
PIT4581001:Vmn2r5	UTSW	3	64503927	nonsense	probably null
R0063:Vmn2r5	UTSW	3	64503800	missense	probably benign	0.01
R0142:Vmn2r5	UTSW	3	64492588	missense	probably damaging	1.00
R0193:Vmn2r5	UTSW	3	64491530	missense	possibly damaging	0.91
R0219:Vmn2r5	UTSW	3	64504313	missense	probably damaging	0.99
R0313:Vmn2r5	UTSW	3	64503827	missense	probably benign
R0620:Vmn2r5	UTSW	3	64503814	nonsense	probably null
R0726:Vmn2r5	UTSW	3	64503765	missense	probably benign	0.01
R1073:Vmn2r5	UTSW	3	64491305	nonsense	probably null
R1549:Vmn2r5	UTSW	3	64504000	missense	probably damaging	1.00
R1581:Vmn2r5	UTSW	3	64491219	missense	probably damaging	1.00
R1624:Vmn2r5	UTSW	3	64509695	missense	probably benign	0.19
R1973:Vmn2r5	UTSW	3	64504221	missense	probably damaging	1.00
R1974:Vmn2r5	UTSW	3	64504221	missense	probably damaging	1.00
R1975:Vmn2r5	UTSW	3	64504221	missense	probably damaging	1.00
R1977:Vmn2r5	UTSW	3	64504221	missense	probably damaging	1.00
R2484:Vmn2r5	UTSW	3	64503971	missense	possibly damaging	0.94
R4573:Vmn2r5	UTSW	3	64503918	missense	probably damaging	0.98
R5243:Vmn2r5	UTSW	3	64504076	missense	probably damaging	1.00
R5384:Vmn2r5	UTSW	3	64509510	missense	probably benign	0.02
R5385:Vmn2r5	UTSW	3	64509510	missense	probably benign	0.02
R5587:Vmn2r5	UTSW	3	64504076	missense	probably damaging	1.00
R5588:Vmn2r5	UTSW	3	64504076	missense	probably damaging	1.00
R5589:Vmn2r5	UTSW	3	64504076	missense	probably damaging	1.00
R5590:Vmn2r5	UTSW	3	64504076	missense	probably damaging	1.00
R5739:Vmn2r5	UTSW	3	64504076	missense	probably damaging	1.00
R6113:Vmn2r5	UTSW	3	64491399	missense	probably benign	0.03
R6739:Vmn2r5	UTSW	3	64491216	missense	probably damaging	0.97
R7106:Vmn2r5	UTSW	3	64491683	missense	probably benign	0.05
R7304:Vmn2r5	UTSW	3	64504250	missense	probably damaging	0.97
R7402:Vmn2r5	UTSW	3	64495755	missense	probably benign	0.05
R7477:Vmn2r5	UTSW	3	64491639	missense	probably damaging	1.00
R7571:Vmn2r5	UTSW	3	64504404	missense	probably damaging	1.00
R7678:Vmn2r5	UTSW	3	64509522	missense	probably benign
R7874:Vmn2r5	UTSW	3	64491032	missense	probably damaging	1.00
R8110:Vmn2r5	UTSW	3	64491288	missense	probably benign	0.00
R8223:Vmn2r5	UTSW	3	64491305	nonsense	probably null
R8767:Vmn2r5	UTSW	3	64507682	missense	possibly damaging	0.79
R8896:Vmn2r5	UTSW	3	64503782	missense	probably benign	0.00
R8948:Vmn2r5	UTSW	3	64491101	missense	probably damaging	1.00
R8950:Vmn2r5	UTSW	3	64491101	missense	probably damaging	1.00
R8962:Vmn2r5	UTSW	3	64491143	missense	probably damaging	1.00
R9012:Vmn2r5	UTSW	3	64504494	missense	probably damaging	1.00
R9109:Vmn2r5	UTSW	3	64503990	missense	possibly damaging	0.58
R9126:Vmn2r5	UTSW	3	64491738	missense	probably benign	0.13
R9192:Vmn2r5	UTSW	3	64491517	nonsense	probably null
R9221:Vmn2r5	UTSW	3	64504300	nonsense	probably null
R9375:Vmn2r5	UTSW	3	64503895	missense	probably damaging	1.00
R9529:Vmn2r5	UTSW	3	64492597	missense	probably benign	0.06
Z1088:Vmn2r5	UTSW	3	64509542	missense	probably benign	0.02
Z1177:Vmn2r5	UTSW	3	64491051	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAATACAGGTCCCATGATAACC -3'
(R):5'- CACTTCTACACTCCATCAAGGTG -3'

Sequencing Primer
(F):5'- ATGATAACCAGTCCTTTCAGGC -3'
(R):5'- AGGTGCTTCCTTCAAACCTGTG -3'

Posted On

2014-10-02