Incidental Mutation 'R2189:Esrp1'
ID237959
Institutional Source Beutler Lab
Gene Symbol Esrp1
Ensembl Gene ENSMUSG00000040728
Gene Nameepithelial splicing regulatory protein 1
Synonyms2210008M09Rik, Rbm35a
MMRRC Submission 040191-MU
Accession Numbers

Genbank: NM_194055; MGI: 1917326

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11331933-11386783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11357603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 503 (M503K)
Ref Sequence ENSEMBL: ENSMUSP00000103949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043781] [ENSMUST00000108310] [ENSMUST00000108311] [ENSMUST00000108313] [ENSMUST00000147342] [ENSMUST00000155519]
Predicted Effect probably benign
Transcript: ENSMUST00000043781
AA Change: M503K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037921
Gene: ENSMUSG00000040728
AA Change: M503K

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108310
AA Change: M503K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103946
Gene: ENSMUSG00000040728
AA Change: M503K

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108311
AA Change: M503K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103947
Gene: ENSMUSG00000040728
AA Change: M503K

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108313
AA Change: M503K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103949
Gene: ENSMUSG00000040728
AA Change: M503K

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147342
AA Change: M338K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121117
Gene: ENSMUSG00000040728
AA Change: M338K

DomainStartEndE-ValueType
RRM 61 133 2.6e-2 SMART
RRM 162 237 1.75e-5 SMART
low complexity region 255 269 N/A INTRINSIC
RRM 281 356 1.03e-2 SMART
low complexity region 377 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155519
SMART Domains Protein: ENSMUSP00000119598
Gene: ENSMUSG00000040728

DomainStartEndE-ValueType
RRM 212 284 2.6e-2 SMART
RRM 313 388 1.75e-5 SMART
low complexity region 406 420 N/A INTRINSIC
Blast:RRM 432 472 7e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR1 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit hyperactivity and circling with no detectable hearing deficits. Mice homozygous for a null allele exhibit bilateral cleft lip and cleft palate, and die at P0. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Esrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Esrp1 APN 4 11384374 missense possibly damaging 0.47
IGL02251:Esrp1 APN 4 11361202 missense probably damaging 1.00
IGL02669:Esrp1 APN 4 11386324 missense possibly damaging 0.61
Barley UTSW 4 11365205 missense probably damaging 1.00
korn UTSW 4 11357519 missense probably damaging 1.00
triaka UTSW 4 11379300 missense probably benign 0.01
R1109:Esrp1 UTSW 4 11365205 missense probably damaging 1.00
R1531:Esrp1 UTSW 4 11379375 missense probably damaging 0.99
R2255:Esrp1 UTSW 4 11365211 missense probably damaging 0.99
R5919:Esrp1 UTSW 4 11344146 missense probably damaging 0.96
R5924:Esrp1 UTSW 4 11361174 missense probably damaging 1.00
R6042:Esrp1 UTSW 4 11357580 missense possibly damaging 0.93
R6749:Esrp1 UTSW 4 11357519 missense probably damaging 1.00
R6817:Esrp1 UTSW 4 11357552 missense probably damaging 1.00
R7392:Esrp1 UTSW 4 11338809 missense probably benign 0.00
R7607:Esrp1 UTSW 4 11384449 missense probably damaging 0.99
R7985:Esrp1 UTSW 4 11367153 missense probably benign 0.17
R8050:Esrp1 UTSW 4 11338767 missense probably damaging 1.00
Z1176:Esrp1 UTSW 4 11384396 missense probably damaging 1.00
Z1176:Esrp1 UTSW 4 11385765 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGATGAAAGCAGCTTAAGCAC -3'
(R):5'- CGGTCACCCAGATTTTGTGG -3'

Sequencing Primer
(F):5'- GATGAAAGCAGCTTAAGCACCTACC -3'
(R):5'- GGTCACCCAGATTTTGTGGCTAAC -3'
Posted On2014-10-02