Incidental Mutation 'R2189:Yars'
ID237960
Institutional Source Beutler Lab
Gene Symbol Yars
Ensembl Gene ENSMUSG00000028811
Gene Nametyrosyl-tRNA synthetase
Synonyms
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129189760-129219607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129206189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 227 (I227V)
Ref Sequence ENSEMBL: ENSMUSP00000101669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106054]
Predicted Effect probably damaging
Transcript: ENSMUST00000106054
AA Change: I227V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811
AA Change: I227V

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133992
SMART Domains Protein: ENSMUSP00000118512
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 75 2.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146106
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Yars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Yars APN 4 129206142 missense probably damaging 1.00
IGL02039:Yars APN 4 129215259 missense probably damaging 1.00
IGL03324:Yars APN 4 129210535 missense probably benign 0.01
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0646:Yars UTSW 4 129213939 unclassified probably benign
R0746:Yars UTSW 4 129197286 missense probably damaging 1.00
R0894:Yars UTSW 4 129197155 missense probably damaging 0.97
R2115:Yars UTSW 4 129207923 intron probably null
R2134:Yars UTSW 4 129197199 nonsense probably null
R4190:Yars UTSW 4 129200027 nonsense probably null
R4863:Yars UTSW 4 129189882 unclassified probably benign
R4915:Yars UTSW 4 129210591 unclassified probably benign
R5450:Yars UTSW 4 129197246 missense possibly damaging 0.94
R5631:Yars UTSW 4 129209749 missense probably damaging 1.00
R5789:Yars UTSW 4 129196897 missense probably damaging 1.00
R6384:Yars UTSW 4 129196978 critical splice donor site probably null
R6837:Yars UTSW 4 129209751 missense possibly damaging 0.77
R7713:Yars UTSW 4 129210498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGTAATGATCGCACATGAAC -3'
(R):5'- CACACCTGGTTAGCATGGAC -3'

Sequencing Primer
(F):5'- ATGAACTCCACAGCTGTTTCTGAG -3'
(R):5'- CATTGTTTTCTCATCTGCAGAGCAAG -3'
Posted On2014-10-02