Incidental Mutation 'R2189:V1ra8'
ID237963
Institutional Source Beutler Lab
Gene Symbol V1ra8
Ensembl Gene ENSMUSG00000062546
Gene Namevomeronasal 1 receptor, A8
Synonyms
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2189 (G1)
Quality Score101
Status Not validated
Chromosome6
Chromosomal Location90202793-90203682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90202962 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 49 (D49A)
Ref Sequence ENSEMBL: ENSMUSP00000077479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078371]
Predicted Effect probably damaging
Transcript: ENSMUST00000078371
AA Change: D49A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077479
Gene: ENSMUSG00000062546
AA Change: D49A

DomainStartEndE-ValueType
Pfam:V1R 38 272 2e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in V1ra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:V1ra8 APN 6 90203202 missense probably benign 0.17
IGL02572:V1ra8 APN 6 90203058 missense probably damaging 1.00
R0368:V1ra8 UTSW 6 90202962 missense probably damaging 1.00
R0395:V1ra8 UTSW 6 90203009 missense possibly damaging 0.93
R1476:V1ra8 UTSW 6 90203150 missense probably damaging 1.00
R1709:V1ra8 UTSW 6 90203322 missense probably damaging 1.00
R2288:V1ra8 UTSW 6 90203042 missense probably damaging 1.00
R3962:V1ra8 UTSW 6 90203484 missense probably benign 0.02
R5380:V1ra8 UTSW 6 90203022 missense probably damaging 1.00
R5469:V1ra8 UTSW 6 90203204 missense probably benign 0.00
R5521:V1ra8 UTSW 6 90203054 missense probably damaging 1.00
R5651:V1ra8 UTSW 6 90203526 missense probably benign 0.18
R6088:V1ra8 UTSW 6 90203100 missense probably damaging 1.00
R6527:V1ra8 UTSW 6 90203313 missense probably damaging 0.97
R7804:V1ra8 UTSW 6 90203316 missense probably damaging 1.00
R8326:V1ra8 UTSW 6 90203264 missense possibly damaging 0.55
R8355:V1ra8 UTSW 6 90203465 missense probably damaging 1.00
R8427:V1ra8 UTSW 6 90203577 missense probably damaging 1.00
R8455:V1ra8 UTSW 6 90203465 missense probably damaging 1.00
R8483:V1ra8 UTSW 6 90202934 missense probably benign 0.09
RF008:V1ra8 UTSW 6 90203609 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAACTACTACGTGCTTCTACCC -3'
(R):5'- TTGAGCTTTGCTAAGTGAGAGC -3'

Sequencing Primer
(F):5'- TGCTTCTACCCAGCATAACATG -3'
(R):5'- TGATGGCCTGGAAGACACTC -3'
Posted On2014-10-02