Incidental Mutation 'R2189:Tnfrsf1a'
ID237964
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1a
Ensembl Gene ENSMUSG00000030341
Gene Nametumor necrosis factor receptor superfamily, member 1a
SynonymsCD120a, TNFalpha-R1, TNF-R1, p55-R, TNF receptor alpha chain, TNF-R55, TNFRI, TNFRp55, TNFAR, TNFR60, TNF-R-I, Tnfr1, p55, TNF-alpha-R1, TNF-alphaR1
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125349362-125362484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125357805 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 14 (L14Q)
Ref Sequence ENSEMBL: ENSMUSP00000117470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000042647] [ENSMUST00000130257] [ENSMUST00000144524]
Predicted Effect probably benign
Transcript: ENSMUST00000032491
AA Change: L136Q

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341
AA Change: L136Q

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042647
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000125880
AA Change: L52Q
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341
AA Change: L52Q

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130257
SMART Domains Protein: ENSMUSP00000115991
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TNFR_c6 44 66 1.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134803
Predicted Effect probably benign
Transcript: ENSMUST00000144524
AA Change: L14Q

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341
AA Change: L14Q

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mice lacking a functional copy of this gene exhibit impaired immune function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted splenic architecture, increased adult liver weights, reduced IgG immune response, deficits in some host defense and inflammatory responses, LPS resistance, and reduced graft-vs-host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Tnfrsf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Tnfrsf1a APN 6 125356864 missense probably damaging 1.00
IGL02468:Tnfrsf1a APN 6 125357861 missense probably benign 0.06
IGL02588:Tnfrsf1a APN 6 125360766 missense probably benign 0.44
R1302:Tnfrsf1a UTSW 6 125356916 missense probably damaging 1.00
R4559:Tnfrsf1a UTSW 6 125360766 missense probably benign 0.44
R4794:Tnfrsf1a UTSW 6 125358084 missense probably damaging 1.00
R5039:Tnfrsf1a UTSW 6 125360712 missense possibly damaging 0.67
R5364:Tnfrsf1a UTSW 6 125357393 missense possibly damaging 0.87
R5792:Tnfrsf1a UTSW 6 125358077 missense probably damaging 1.00
R6742:Tnfrsf1a UTSW 6 125356948 missense probably damaging 0.99
R7018:Tnfrsf1a UTSW 6 125356951 missense probably damaging 1.00
R7128:Tnfrsf1a UTSW 6 125361536 missense probably benign 0.11
R7192:Tnfrsf1a UTSW 6 125361596 missense unknown
R7715:Tnfrsf1a UTSW 6 125361414 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TTACAAAGACGAATGCCATGTGG -3'
(R):5'- GTTAAGACTAAGAGCGCGTGC -3'

Sequencing Primer
(F):5'- GGATGTGAGACTCACACA -3'
(R):5'- TGCCTGCAGTCTGAGGG -3'
Posted On2014-10-02