Incidental Mutation 'R2189:Clptm1'
ID237966
Institutional Source Beutler Lab
Gene Symbol Clptm1
Ensembl Gene ENSMUSG00000002981
Gene Namecleft lip and palate associated transmembrane protein 1
SynonymsN14, HS9
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19631571-19665033 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19637145 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 355 (Y355*)
Ref Sequence ENSEMBL: ENSMUSP00000051293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055242]
Predicted Effect probably null
Transcript: ENSMUST00000055242
AA Change: Y355*
SMART Domains Protein: ENSMUSP00000051293
Gene: ENSMUSG00000002981
AA Change: Y355*

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Pfam:CLPTM1 56 497 5.8e-148 PFAM
transmembrane domain 507 529 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Clptm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Clptm1 APN 7 19637700 missense probably benign 0.14
IGL01909:Clptm1 APN 7 19655776 missense probably benign 0.37
IGL03089:Clptm1 APN 7 19637147 missense probably damaging 1.00
H8786:Clptm1 UTSW 7 19635704 missense possibly damaging 0.54
R0128:Clptm1 UTSW 7 19635007 missense probably damaging 1.00
R0835:Clptm1 UTSW 7 19635674 missense possibly damaging 0.61
R1167:Clptm1 UTSW 7 19634211 missense probably damaging 1.00
R1370:Clptm1 UTSW 7 19633872 missense possibly damaging 0.61
R1655:Clptm1 UTSW 7 19645867 missense probably benign 0.00
R1855:Clptm1 UTSW 7 19638209 missense probably benign 0.05
R2004:Clptm1 UTSW 7 19646837 missense possibly damaging 0.46
R2203:Clptm1 UTSW 7 19633892 missense possibly damaging 0.92
R3237:Clptm1 UTSW 7 19635346 missense probably damaging 0.99
R3963:Clptm1 UTSW 7 19638196 nonsense probably null
R5416:Clptm1 UTSW 7 19633816 unclassified probably benign
R6110:Clptm1 UTSW 7 19633806 unclassified probably benign
R6474:Clptm1 UTSW 7 19635837 missense possibly damaging 0.94
R6737:Clptm1 UTSW 7 19637076 critical splice donor site probably null
R6897:Clptm1 UTSW 7 19635826 missense possibly damaging 0.94
R8144:Clptm1 UTSW 7 19633902 missense possibly damaging 0.88
R8244:Clptm1 UTSW 7 19638991 missense possibly damaging 0.46
R8374:Clptm1 UTSW 7 19638156 missense probably benign 0.13
R8438:Clptm1 UTSW 7 19645851 missense probably benign 0.00
Z1177:Clptm1 UTSW 7 19637468 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCAGCCCTCTAGAGTACAG -3'
(R):5'- CTGTTTCACGACTGCCTAGC -3'

Sequencing Primer
(F):5'- TCTAGAGTACAGAGACCCCAGG -3'
(R):5'- AACCCTAGCTCACCCTGGG -3'
Posted On2014-10-02