Incidental Mutation 'R2189:Fam83e'
ID237969
Institutional Source Beutler Lab
Gene Symbol Fam83e
Ensembl Gene ENSMUSG00000054161
Gene Namefamily with sequence similarity 83, member E
Synonyms4930403C10Rik
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2189 (G1)
Quality Score112
Status Not validated
Chromosome7
Chromosomal Location45721212-45729492 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to T at 45722183 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000114397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072503] [ENSMUST00000094424] [ENSMUST00000107737] [ENSMUST00000129507] [ENSMUST00000209287] [ENSMUST00000209693] [ENSMUST00000210060] [ENSMUST00000210640] [ENSMUST00000211061] [ENSMUST00000211435]
Predicted Effect probably benign
Transcript: ENSMUST00000072503
SMART Domains Protein: ENSMUSP00000072320
Gene: ENSMUSG00000059070

DomainStartEndE-ValueType
PDB:2ZKR|O 1 188 1e-116 PDB
SCOP:d1jj2n_ 22 139 1e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094424
SMART Domains Protein: ENSMUSP00000091991
Gene: ENSMUSG00000070563

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:UPAR_LY6 23 97 1.7e-7 PFAM
low complexity region 99 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107737
SMART Domains Protein: ENSMUSP00000103366
Gene: ENSMUSG00000057342

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129507
AA Change: M1I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161
AA Change: M1I

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209287
Predicted Effect probably benign
Transcript: ENSMUST00000209556
Predicted Effect probably benign
Transcript: ENSMUST00000209693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209723
Predicted Effect probably benign
Transcript: ENSMUST00000209867
Predicted Effect probably benign
Transcript: ENSMUST00000210060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210434
Predicted Effect probably benign
Transcript: ENSMUST00000210640
Predicted Effect probably benign
Transcript: ENSMUST00000211061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211425
Predicted Effect probably benign
Transcript: ENSMUST00000211435
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Fam83e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fam83e APN 7 45727069 missense probably benign 0.12
IGL01590:Fam83e APN 7 45723936 missense probably null 1.00
IGL02334:Fam83e APN 7 45723921 missense probably benign 0.00
IGL03155:Fam83e APN 7 45727075 missense possibly damaging 0.90
IGL03276:Fam83e APN 7 45723460 missense possibly damaging 0.72
R0268:Fam83e UTSW 7 45726910 missense probably benign
R0362:Fam83e UTSW 7 45726969 missense probably benign 0.40
R0453:Fam83e UTSW 7 45723948 missense probably damaging 1.00
R0832:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0870:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0871:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1415:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1656:Fam83e UTSW 7 45722263 missense probably benign
R1848:Fam83e UTSW 7 45728769 nonsense probably null
R1848:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2256:Fam83e UTSW 7 45728769 nonsense probably null
R2256:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2257:Fam83e UTSW 7 45728769 nonsense probably null
R2257:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R4376:Fam83e UTSW 7 45723893 missense probably damaging 1.00
R4600:Fam83e UTSW 7 45723500 missense probably benign 0.01
R5876:Fam83e UTSW 7 45722363 unclassified probably null
R6666:Fam83e UTSW 7 45727002 missense probably benign
R6766:Fam83e UTSW 7 45726646 missense probably damaging 1.00
R6781:Fam83e UTSW 7 45722147 unclassified probably benign
R6933:Fam83e UTSW 7 45722394 missense probably benign
R7320:Fam83e UTSW 7 45722472 missense probably benign 0.16
R7477:Fam83e UTSW 7 45728980 missense probably damaging 1.00
R7636:Fam83e UTSW 7 45727026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTAGGGACTGAGTCG -3'
(R):5'- ACTAGCCAGTCTTCAGCAGC -3'

Sequencing Primer
(F):5'- TAGGGACTGAGTCGGGCAC -3'
(R):5'- AGTCTTCAGCAGCCGTAGC -3'
Posted On2014-10-02