Incidental Mutation 'R0180:Pkp1'
ID23797
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135886800 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 261 (K261R)
Ref Sequence ENSEMBL: ENSMUSP00000128418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably benign
Transcript: ENSMUST00000027667
AA Change: K261R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: K261R

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163260
AA Change: K261R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: K261R

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189805
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0368:Pkp1 UTSW 1 135886852 missense probably benign 0.00
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R0725:Pkp1 UTSW 1 135880740 missense probably benign 0.02
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2190:Pkp1 UTSW 1 135879971 missense probably benign 0.02
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4838:Pkp1 UTSW 1 135882588 missense probably damaging 1.00
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R5908:Pkp1 UTSW 1 135918883 nonsense probably null
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R6232:Pkp1 UTSW 1 135886861 missense probably benign 0.01
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCTGGGAACCAACTACGCAGTG -3'
(R):5'- CCTGAAAGGGATCGCATACCAAGAG -3'

Sequencing Primer
(F):5'- ACTACGCAGTGCTTCCAC -3'
(R):5'- AGATTTTCTCCAAGACAGCCTG -3'
Posted On2013-04-16