Incidental Mutation 'R2189:Olfr691'
ID237971
Institutional Source Beutler Lab
Gene Symbol Olfr691
Ensembl Gene ENSMUSG00000043948
Gene Nameolfactory receptor 691
SynonymsGA_x6K02T2PBJ9-7966695-7965727, MOR31-6
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105335509-105342270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105337602 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000150297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057528] [ENSMUST00000211006] [ENSMUST00000213290] [ENSMUST00000216230]
Predicted Effect probably benign
Transcript: ENSMUST00000057528
AA Change: V38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061078
Gene: ENSMUSG00000043948
AA Change: V38A

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1e-112 PFAM
Pfam:7TM_GPCR_Srsx 37 291 1.3e-10 PFAM
Pfam:7tm_1 43 294 3.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211006
Predicted Effect probably benign
Transcript: ENSMUST00000213290
AA Change: V38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216230
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Olfr691
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Olfr691 APN 7 105337143 missense probably damaging 1.00
R0178:Olfr691 UTSW 7 105336922 missense probably benign 0.07
R0344:Olfr691 UTSW 7 105337607 missense probably benign
R0931:Olfr691 UTSW 7 105337529 nonsense probably null
R1434:Olfr691 UTSW 7 105337261 missense probably benign
R1482:Olfr691 UTSW 7 105337256 missense probably damaging 0.97
R3836:Olfr691 UTSW 7 105337210 missense probably benign 0.05
R5353:Olfr691 UTSW 7 105337117 missense probably damaging 1.00
R6649:Olfr691 UTSW 7 105337707 missense probably benign 0.00
R6715:Olfr691 UTSW 7 105337332 missense probably damaging 1.00
R7462:Olfr691 UTSW 7 105337500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAAGGCAATGTTGTGGGC -3'
(R):5'- GTGAACTTTCTCTTGGGAGCTC -3'

Sequencing Primer
(F):5'- CAATGTTGTGGGCATGGAGC -3'
(R):5'- GGAGCTCAGCAGTTCACAAGTTC -3'
Posted On2014-10-02