Incidental Mutation 'R2189:Olfr481'
ID237973
Institutional Source Beutler Lab
Gene Symbol Olfr481
Ensembl Gene ENSMUSG00000054236
Gene Nameolfactory receptor 481
SynonymsMOR204-39, GA_x6K02T2PBJ9-10409785-10410723, MOR204-2
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108079855-108085824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108081036 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 81 (M81L)
Ref Sequence ENSEMBL: ENSMUSP00000151152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067143] [ENSMUST00000213601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067143
AA Change: M81L

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063555
Gene: ENSMUSG00000054236
AA Change: M81L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.5e-51 PFAM
Pfam:7tm_1 41 290 1.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210338
Predicted Effect possibly damaging
Transcript: ENSMUST00000213601
AA Change: M81L

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Olfr481
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Olfr481 APN 7 108081204 missense probably benign 0.18
IGL01570:Olfr481 APN 7 108081273 missense probably benign 0.38
IGL02619:Olfr481 APN 7 108081742 utr 3 prime probably benign
IGL03175:Olfr481 APN 7 108081718 missense probably benign
R0401:Olfr481 UTSW 7 108080872 missense possibly damaging 0.81
R0932:Olfr481 UTSW 7 108081520 missense probably damaging 1.00
R1679:Olfr481 UTSW 7 108081652 missense probably damaging 1.00
R3804:Olfr481 UTSW 7 108081171 missense probably damaging 1.00
R4532:Olfr481 UTSW 7 108081549 missense probably benign 0.18
R4932:Olfr481 UTSW 7 108081574 missense probably damaging 0.99
R5630:Olfr481 UTSW 7 108081116 missense probably benign 0.05
R6155:Olfr481 UTSW 7 108081286 missense probably benign 0.00
R6523:Olfr481 UTSW 7 108081555 missense probably benign 0.34
R6987:Olfr481 UTSW 7 108081131 nonsense probably null
R7378:Olfr481 UTSW 7 108081192 missense not run
R7609:Olfr481 UTSW 7 108081546 missense probably damaging 0.99
R8293:Olfr481 UTSW 7 108081062 missense probably benign 0.00
V8831:Olfr481 UTSW 7 108081535 missense probably benign 0.24
Z1177:Olfr481 UTSW 7 108081072 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGCTACACTACGTGCTATC -3'
(R):5'- ATGCATCCACCCAAATAGGATG -3'

Sequencing Primer
(F):5'- ACACTACGTGCTATCTTATTTGTG -3'
(R):5'- CAAATAGGATGCCCCGAGC -3'
Posted On2014-10-02