Incidental Mutation 'R2189:Pml'
ID237975
Institutional Source Beutler Lab
Gene Symbol Pml
Ensembl Gene ENSMUSG00000036986
Gene Namepromyelocytic leukemia
SynonymsTrim19, 1200009E24Rik
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58218076-58249786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58234874 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 225 (N225S)
Ref Sequence ENSEMBL: ENSMUSP00000122854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085673] [ENSMUST00000114136] [ENSMUST00000124063] [ENSMUST00000135310] [ENSMUST00000148301] [ENSMUST00000153820]
Predicted Effect probably benign
Transcript: ENSMUST00000085673
AA Change: N225S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082816
Gene: ENSMUSG00000036986
AA Change: N225S

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 5e-7 BLAST
Pfam:DUF3583 244 580 4e-166 PFAM
Blast:EXOIII 619 762 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114136
AA Change: N225S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109771
Gene: ENSMUSG00000036986
AA Change: N225S

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 434 5.5e-109 PFAM
Pfam:DUF3583 428 535 1.4e-57 PFAM
Blast:EXOIII 573 716 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124063
SMART Domains Protein: ENSMUSP00000118232
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126690
AA Change: N216S
SMART Domains Protein: ENSMUSP00000116787
Gene: ENSMUSG00000036986
AA Change: N216S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
RING 54 88 1.83e-3 SMART
BBOX 121 163 4.99e-5 SMART
Blast:BBOX 181 225 4e-7 BLAST
Pfam:DUF3583 236 422 1.4e-89 PFAM
Pfam:DUF3583 411 526 2.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135310
AA Change: N225S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122854
Gene: ENSMUSG00000036986
AA Change: N225S

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 8.8e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138775
Predicted Effect probably benign
Transcript: ENSMUST00000148301
SMART Domains Protein: ENSMUSP00000120620
Gene: ENSMUSG00000036986

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148628
Predicted Effect probably benign
Transcript: ENSMUST00000153820
AA Change: N225S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118955
Gene: ENSMUSG00000036986
AA Change: N225S

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
RING 62 96 1.83e-3 SMART
BBOX 129 171 4.99e-5 SMART
Blast:BBOX 189 233 4e-7 BLAST
Pfam:DUF3583 244 581 9.2e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154572
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene have an increased susceptibility to infection and to induction of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Pml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Pml APN 9 58247003 missense probably benign 0.04
IGL03147:Pml UTSW 9 58230043 missense possibly damaging 0.85
R0019:Pml UTSW 9 58220493 missense probably damaging 1.00
R0905:Pml UTSW 9 58249539 critical splice donor site probably null
R1171:Pml UTSW 9 58234538 missense probably damaging 1.00
R2330:Pml UTSW 9 58234571 missense probably damaging 1.00
R2909:Pml UTSW 9 58247243 missense possibly damaging 0.75
R4749:Pml UTSW 9 58234652 missense probably damaging 0.99
R5228:Pml UTSW 9 58219997 missense probably damaging 1.00
R5300:Pml UTSW 9 58247019 missense probably damaging 1.00
R5669:Pml UTSW 9 58247063 missense probably benign 0.00
R5876:Pml UTSW 9 58233182 missense possibly damaging 0.71
R6854:Pml UTSW 9 58219906 missense probably damaging 0.99
R6996:Pml UTSW 9 58234886 missense probably damaging 1.00
R7387:Pml UTSW 9 58229894 missense probably benign 0.08
R7448:Pml UTSW 9 58247213 missense probably benign 0.27
R7762:Pml UTSW 9 58220173 missense probably damaging 1.00
R7833:Pml UTSW 9 58234685 missense probably benign 0.15
R7834:Pml UTSW 9 58234685 missense probably benign 0.15
R7903:Pml UTSW 9 58249584 missense probably benign 0.01
R7916:Pml UTSW 9 58234685 missense probably benign 0.15
R7917:Pml UTSW 9 58234685 missense probably benign 0.15
R7986:Pml UTSW 9 58249584 missense probably benign 0.01
R8040:Pml UTSW 9 58234685 missense probably benign 0.15
R8041:Pml UTSW 9 58234685 missense probably benign 0.15
R8042:Pml UTSW 9 58234685 missense probably benign 0.15
R8046:Pml UTSW 9 58246973 critical splice donor site probably null
Z1088:Pml UTSW 9 58234590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTCAATGTCTGCGCGTGC -3'
(R):5'- CGGTGGAGGAATCGTTAACTG -3'

Sequencing Primer
(F):5'- CGTGGTCCAGCTGTCCTATAG -3'
(R):5'- CAACTCAGGTTGTCAGACTTGGC -3'
Posted On2014-10-02