Incidental Mutation 'R2189:Icosl'
ID237977
Institutional Source Beutler Lab
Gene Symbol Icosl
Ensembl Gene ENSMUSG00000000732
Gene Nameicos ligand
SynonymsB7h, B7-H2, B7RP-1, GL50, GL50-B, ICOS-L, LICOS
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78069302-78083913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78073925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 235 (T235A)
Ref Sequence ENSEMBL: ENSMUSP00000101032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105393
AA Change: T235A

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101032
Gene: ENSMUSG00000000732
AA Change: T235A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
IG 47 161 4.67e-4 SMART
Pfam:C2-set_2 165 253 5.2e-9 PFAM
transmembrane domain 280 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217675
Predicted Effect unknown
Transcript: ENSMUST00000219038
AA Change: T231A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219633
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit defects in the humoral immune response associated with an impaired interactions between T and B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Icosl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Icosl APN 10 78071971 missense probably damaging 1.00
IGL02540:Icosl APN 10 78069536 critical splice donor site probably null
R0304:Icosl UTSW 10 78075322 missense probably benign
R0512:Icosl UTSW 10 78071966 missense possibly damaging 0.77
R0584:Icosl UTSW 10 78071875 missense possibly damaging 0.82
R0711:Icosl UTSW 10 78073941 missense probably damaging 1.00
R2005:Icosl UTSW 10 78071953 missense possibly damaging 0.63
R2006:Icosl UTSW 10 78071953 missense possibly damaging 0.63
R3417:Icosl UTSW 10 78072035 missense possibly damaging 0.46
R4423:Icosl UTSW 10 78071873 missense possibly damaging 0.92
R5183:Icosl UTSW 10 78069485 unclassified probably benign
R5579:Icosl UTSW 10 78073763 missense probably damaging 0.99
R6388:Icosl UTSW 10 78069532 missense possibly damaging 0.96
R7336:Icosl UTSW 10 78073873 nonsense probably null
R7921:Icosl UTSW 10 78073740 missense probably benign 0.01
R7921:Icosl UTSW 10 78073952 missense probably benign 0.02
R8733:Icosl UTSW 10 78073863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAACGTACCTACACCTG -3'
(R):5'- AGTTCTTGTGACAGGCCAGAG -3'

Sequencing Primer
(F):5'- TACACCTGCATGTCCAAGAATG -3'
(R):5'- CTCTCTGATAGGGATCATCTGTAAG -3'
Posted On2014-10-02