Incidental Mutation 'R2189:Myh1'
ID237979
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Namemyosin, heavy polypeptide 1, skeletal muscle, adult
SynonymsA530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67200052-67224575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67221604 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1799 (D1799G)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
Predicted Effect probably damaging
Transcript: ENSMUST00000018637
AA Change: D1799G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: D1799G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075734
AA Change: D1799G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: D1799G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124516
AA Change: D1799G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: D1799G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149070
Meta Mutation Damage Score 0.2144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6813:Myh1 UTSW 11 67220460 missense probably benign 0.34
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATCACTGATGTAAGCAGAG -3'
(R):5'- CTAAGCTGTCAGGCAACAGG -3'

Sequencing Primer
(F):5'- CATCACTGATGTAAGCAGAGAGTGAG -3'
(R):5'- GGCAACAGGGACTATATGCTCTTC -3'
Posted On2014-10-02