Incidental Mutation 'R2189:Eral1'
ID237982
Institutional Source Beutler Lab
Gene Symbol Eral1
Ensembl Gene ENSMUSG00000020832
Gene NameEra (G-protein)-like 1 (E. coli)
Synonyms2610524P08Rik, 9130407C09Rik, MERA-W, MERA-S
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78073376-78080383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78075831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000021183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021183]
Predicted Effect probably benign
Transcript: ENSMUST00000021183
AA Change: V201A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021183
Gene: ENSMUSG00000020832
AA Change: V201A

DomainStartEndE-ValueType
low complexity region 79 92 N/A INTRINSIC
Pfam:AIG1 114 249 2.2e-11 PFAM
Pfam:FeoB_N 114 260 5e-10 PFAM
Pfam:MMR_HSR1 115 237 4e-21 PFAM
Pfam:Dynamin_N 116 162 1.6e-6 PFAM
Pfam:KH_2 363 437 6.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase that localizes to the mitochondrion. The encoded protein binds to the 3' terminal stem loop of 12S mitochondrial rRNA and is required for proper assembly of the 28S small mitochondrial ribosomal subunit. Deletion of this gene has been shown to cause mitochondrial dysfunction, growth retardation, and apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Eral1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Eral1 APN 11 78075732 missense probably damaging 1.00
IGL01643:Eral1 APN 11 78074278 critical splice donor site probably null
IGL02240:Eral1 APN 11 78077861 nonsense probably null
IGL03085:Eral1 APN 11 78078267 missense probably damaging 1.00
K3955:Eral1 UTSW 11 78076021 missense probably damaging 1.00
P0038:Eral1 UTSW 11 78076021 missense probably damaging 1.00
R0240:Eral1 UTSW 11 78076058 splice site probably benign
R1084:Eral1 UTSW 11 78074498 missense probably damaging 0.96
R1563:Eral1 UTSW 11 78075406 missense probably benign 0.39
R1881:Eral1 UTSW 11 78076049 missense possibly damaging 0.67
R1995:Eral1 UTSW 11 78074489 missense probably benign
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R2870:Eral1 UTSW 11 78076278 missense possibly damaging 0.95
R4049:Eral1 UTSW 11 78075602 missense probably damaging 1.00
R4585:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4586:Eral1 UTSW 11 78078304 missense probably damaging 1.00
R4758:Eral1 UTSW 11 78075599 missense probably benign 0.20
R5450:Eral1 UTSW 11 78078357 missense probably benign 0.23
R5613:Eral1 UTSW 11 78074404 intron probably benign
R5987:Eral1 UTSW 11 78080233 missense possibly damaging 0.90
R6048:Eral1 UTSW 11 78075783 missense probably benign 0.03
R6363:Eral1 UTSW 11 78074317 missense probably damaging 1.00
R6891:Eral1 UTSW 11 78075733 missense possibly damaging 0.76
R7384:Eral1 UTSW 11 78074101 missense possibly damaging 0.81
R7468:Eral1 UTSW 11 78075393 missense probably damaging 1.00
R7762:Eral1 UTSW 11 78074533 missense possibly damaging 0.94
R8304:Eral1 UTSW 11 78076002 missense probably damaging 0.96
R8419:Eral1 UTSW 11 78074080 missense possibly damaging 0.73
R8433:Eral1 UTSW 11 78075483 missense probably benign
X0066:Eral1 UTSW 11 78075765 missense probably damaging 1.00
Z1176:Eral1 UTSW 11 78075620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGACTTCTGCTTCAGGC -3'
(R):5'- CGAGCATGGAATCTGCTGATC -3'

Sequencing Primer
(F):5'- ATCTACCTGGACATGCGGGATG -3'
(R):5'- CTGCTGATCTTGGTTAGACTCAAAC -3'
Posted On2014-10-02