Incidental Mutation 'R2189:Sugct'
ID237987
Institutional Source Beutler Lab
Gene Symbol Sugct
Ensembl Gene ENSMUSG00000055137
Gene Namesuccinyl-CoA glutarate-CoA transferase
Synonyms5033411D12Rik
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location16857472-17695553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17662266 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 104 (I104V)
Ref Sequence ENSEMBL: ENSMUSP00000070759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068545] [ENSMUST00000221598]
Predicted Effect probably benign
Transcript: ENSMUST00000068545
AA Change: I104V

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070759
Gene: ENSMUSG00000055137
AA Change: I104V

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
Pfam:CoA_transf_3 39 406 3.4e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221598
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to members of the CaiB/baiF CoA-transferase protein family. Mutations in this gene are associated with glutaric aciduria type III. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Sugct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Sugct APN 13 17662772 missense probably damaging 1.00
IGL00917:Sugct APN 13 16857918 nonsense probably null
IGL02118:Sugct APN 13 17452520 nonsense probably null
IGL02267:Sugct APN 13 17644865 missense possibly damaging 0.94
IGL02285:Sugct APN 13 17672596 missense possibly damaging 0.51
IGL02412:Sugct APN 13 17662801 missense probably damaging 1.00
IGL02420:Sugct APN 13 17452468 missense probably damaging 1.00
IGL02703:Sugct APN 13 17452540 missense possibly damaging 0.94
IGL03098:Sugct UTSW 13 17671736 missense probably damaging 1.00
R0024:Sugct UTSW 13 16857869 missense probably benign 0.01
R0024:Sugct UTSW 13 16857869 missense probably benign 0.01
R0058:Sugct UTSW 13 17672581 missense probably damaging 1.00
R1472:Sugct UTSW 13 17452546 missense probably benign 0.26
R1709:Sugct UTSW 13 17672566 missense probably damaging 0.99
R1780:Sugct UTSW 13 17452454 splice site probably null
R4420:Sugct UTSW 13 17452545 missense probably damaging 1.00
R4763:Sugct UTSW 13 17662787 missense probably damaging 1.00
R5197:Sugct UTSW 13 17323276 missense probably damaging 0.99
R5310:Sugct UTSW 13 17252560 nonsense probably null
R5401:Sugct UTSW 13 16857870 missense probably damaging 1.00
R6695:Sugct UTSW 13 17323230 missense possibly damaging 0.94
R6962:Sugct UTSW 13 16858021 splice site probably null
R6991:Sugct UTSW 13 17554380 missense probably benign 0.23
R7135:Sugct UTSW 13 17302009 missense probably benign 0.00
R7141:Sugct UTSW 13 17644787 missense possibly damaging 0.76
R7367:Sugct UTSW 13 17644814 missense probably damaging 0.97
R7753:Sugct UTSW 13 17577519 missense possibly damaging 0.79
R8053:Sugct UTSW 13 17301969 missense probably damaging 1.00
R8234:Sugct UTSW 13 16857874 missense probably benign 0.01
R8336:Sugct UTSW 13 16857919 missense probably benign 0.30
R8351:Sugct UTSW 13 17252558 missense probably damaging 1.00
R8451:Sugct UTSW 13 17252558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTATGCTTGCTTAAACAATGTC -3'
(R):5'- GTATGCTTCTTGGTGTCAGATAAAC -3'

Sequencing Primer
(F):5'- AAGCCATACTTCCTGGATCCAGTG -3'
(R):5'- CTTCTTGGTGTCAGATAAACATTTTG -3'
Posted On2014-10-02