Incidental Mutation 'R2189:Hist1h2bn'
ID237988
Institutional Source Beutler Lab
Gene Symbol Hist1h2bn
Ensembl Gene ENSMUSG00000095217
Gene Namehistone cluster 1, H2bn
Synonyms
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2189 (G1)
Quality Score90
Status Not validated
Chromosome13
Chromosomal Location21754123-21754503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21754277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000089301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074752] [ENSMUST00000091709] [ENSMUST00000102983]
Predicted Effect probably benign
Transcript: ENSMUST00000074752
SMART Domains Protein: ENSMUSP00000074310
Gene: ENSMUSG00000063021

DomainStartEndE-ValueType
H2A 3 123 1.22e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091709
AA Change: D52G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089301
Gene: ENSMUSG00000095217
AA Change: D52G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102983
SMART Domains Protein: ENSMUSP00000100048
Gene: ENSMUSG00000064288

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198541
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Hist1h2bn
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Hist1h2bn UTSW 13 21754478 missense probably benign 0.11
R1037:Hist1h2bn UTSW 13 21754247 missense probably damaging 0.97
R6379:Hist1h2bn UTSW 13 21754418 missense probably benign 0.05
R6415:Hist1h2bn UTSW 13 21754486 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGGCTTTTGGTCAGTTCCTAC -3'
(R):5'- CTCACTTGGAGCTGGTGTAC -3'

Sequencing Primer
(F):5'- AGTTCCTACCATGCCTGAAC -3'
(R):5'- ACTTGGTGACAGCCTTGG -3'
Posted On2014-10-02