Incidental Mutation 'R2189:Tnk2'
ID237993
Institutional Source Beutler Lab
Gene Symbol Tnk2
Ensembl Gene ENSMUSG00000022791
Gene Nametyrosine kinase, non-receptor, 2
SynonymsACK1, Ack, P21cdc42Hs kinase, Pyk1, activated p21cdc42Hs kinase
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32643874-32683493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32671421 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 381 (L381F)
Ref Sequence ENSEMBL: ENSMUSP00000110779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115120] [ENSMUST00000115121] [ENSMUST00000115122] [ENSMUST00000115123] [ENSMUST00000115124] [ENSMUST00000115125] [ENSMUST00000115126] [ENSMUST00000131238] [ENSMUST00000145627] [ENSMUST00000152361]
Predicted Effect probably benign
Transcript: ENSMUST00000115120
SMART Domains Protein: ENSMUSP00000110773
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1.1e-8 PFAM
low complexity region 247 264 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 284 351 2.9e-30 PFAM
low complexity region 391 419 N/A INTRINSIC
Pfam:UBA 467 505 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115121
SMART Domains Protein: ENSMUSP00000110774
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 4.5e-9 PFAM
low complexity region 27 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115122
Predicted Effect probably damaging
Transcript: ENSMUST00000115123
AA Change: L381F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110776
Gene: ENSMUSG00000022791
AA Change: L381F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 3e-30 PFAM
low complexity region 881 909 N/A INTRINSIC
Pfam:UBA 957 995 1.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115124
AA Change: L381F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110777
Gene: ENSMUSG00000022791
AA Change: L381F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 855 5.3e-29 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115125
AA Change: L381F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110778
Gene: ENSMUSG00000022791
AA Change: L381F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 737 754 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 774 841 7.2e-31 PFAM
low complexity region 881 909 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115126
AA Change: L381F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110779
Gene: ENSMUSG00000022791
AA Change: L381F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TyrKc 43 79 3e-14 BLAST
TyrKc 126 385 1.44e-129 SMART
SH3 391 447 1.52e-7 SMART
low complexity region 517 524 N/A INTRINSIC
low complexity region 752 769 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 789 856 2.9e-30 PFAM
low complexity region 896 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131238
SMART Domains Protein: ENSMUSP00000129382
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
Pfam:GTPase_binding 1 24 1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141256
Predicted Effect probably benign
Transcript: ENSMUST00000145627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150383
Predicted Effect probably benign
Transcript: ENSMUST00000152361
SMART Domains Protein: ENSMUSP00000125905
Gene: ENSMUSG00000022791

DomainStartEndE-ValueType
SCOP:d1jo8a_ 8 38 2e-3 SMART
Pfam:GTPase_binding 39 106 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168506
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase that binds Cdc42Hs in its GTP-bound form and inhibits both the intrinsic and GTPase-activating protein (GAP)-stimulated GTPase activity of Cdc42Hs. This binding is mediated by a unique sequence of 47 amino acids C-terminal to an SH3 domain. The protein may be involved in a regulatory mechanism that sustains the GTP-bound active form of Cdc42Hs and which is directly linked to a tyrosine phosphorylation signal transduction pathway. Several alternatively spliced transcript variants have been identified from this gene, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lipa A T 19: 34,524,799 L15Q probably benign Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Tnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tnk2 APN 16 32680680 missense probably damaging 0.99
IGL02212:Tnk2 APN 16 32680142 missense probably damaging 0.97
IGL02445:Tnk2 APN 16 32675590 missense probably benign 0.00
IGL02799:Tnk2 UTSW 16 32665881 splice site probably benign
R0310:Tnk2 UTSW 16 32680590 missense probably benign
R0989:Tnk2 UTSW 16 32680358 missense probably damaging 1.00
R1556:Tnk2 UTSW 16 32670919 critical splice donor site probably null
R1851:Tnk2 UTSW 16 32679462 missense probably damaging 1.00
R1854:Tnk2 UTSW 16 32680142 missense probably damaging 0.97
R1938:Tnk2 UTSW 16 32663742 start gained probably benign
R2137:Tnk2 UTSW 16 32670802 unclassified probably null
R3772:Tnk2 UTSW 16 32679822 missense probably damaging 1.00
R4037:Tnk2 UTSW 16 32670796 missense probably damaging 1.00
R4413:Tnk2 UTSW 16 32669501 missense probably damaging 1.00
R4751:Tnk2 UTSW 16 32679857 missense probably damaging 1.00
R4878:Tnk2 UTSW 16 32679630 missense probably damaging 1.00
R4983:Tnk2 UTSW 16 32680465 missense probably damaging 1.00
R5063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
R5541:Tnk2 UTSW 16 32669523 missense probably benign 0.07
R5759:Tnk2 UTSW 16 32680664 missense probably benign
R5888:Tnk2 UTSW 16 32671367 missense probably damaging 1.00
R6142:Tnk2 UTSW 16 32670099 missense probably damaging 1.00
R6372:Tnk2 UTSW 16 32679785 missense probably damaging 1.00
R6717:Tnk2 UTSW 16 32670869 missense probably damaging 1.00
R6939:Tnk2 UTSW 16 32663878 missense probably damaging 1.00
R7157:Tnk2 UTSW 16 32681168 missense probably damaging 1.00
R7292:Tnk2 UTSW 16 32680800 missense probably benign
R7362:Tnk2 UTSW 16 32675520 critical splice acceptor site probably null
R7477:Tnk2 UTSW 16 32677891 splice site probably null
R7558:Tnk2 UTSW 16 32680085 missense probably benign
R7665:Tnk2 UTSW 16 32680526 missense probably damaging 1.00
R7731:Tnk2 UTSW 16 32670134 missense possibly damaging 0.69
R7867:Tnk2 UTSW 16 32681235 missense probably damaging 0.99
R7950:Tnk2 UTSW 16 32681235 missense probably damaging 0.99
R8011:Tnk2 UTSW 16 32668365 missense probably benign 0.00
X0063:Tnk2 UTSW 16 32670850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGGTATCTTCAGCTGTAGG -3'
(R):5'- TGTGCAGTTTATCTGGCTCC -3'

Sequencing Primer
(F):5'- GTATCTTCAGCTGTAGGACAGG -3'
(R):5'- TGGCTCCTCAAAGTCCTGAAGAG -3'
Posted On2014-10-02