Mutagenetix > Incidental Mutations

Incidental Mutation 'R2189:Ubr2'

237994

Institutional Source

Beutler Lab

Gene Symbol

Ubr2

Ensembl Gene

ENSMUSG00000023977

Gene Name

ubiquitin protein ligase E3 component n-recognin 2

Synonyms

9930021A08Rik, E130209G04Rik, ENSMUSG00000043296

MMRRC Submission

040191-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.883) question?

Stock #

R2189 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46928295-47010556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46943364 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1454 (V1454I)

Ref Sequence

ENSEMBL: ENSMUSP00000108963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113337]

Predicted Effect

probably benign
Transcript: ENSMUST00000113335
AA Change: V1454I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977
AA Change: V1454I

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	221	302	2.4e-23	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113337
AA Change: V1454I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977
AA Change: V1454I

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	3.14e-32	SMART
Pfam:ClpS	222	301	6.2e-26	PFAM
low complexity region	635	646	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	872	886	N/A	INTRINSIC
coiled coil region	1019	1046	N/A	INTRINSIC
RING	1108	1213	7.66e-1	SMART
low complexity region	1221	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223860

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224759

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225712

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	C	7: 79,098,091	G870A	probably damaging	Het
Adamtsl2	T	C	2: 27,081,738	W12R	probably benign	Het
Bsph1	G	A	7: 13,470,329		probably null	Het
Celsr1	G	T	15: 85,979,230	H1200Q	possibly damaging	Het
Clptm1	A	T	7: 19,637,145	Y355*	probably null	Het
Cry2	T	C	2: 92,411,692	E572G	possibly damaging	Het
Dlk1	G	A	12: 109,455,049		probably null	Het
Eral1	A	G	11: 78,075,831	V201A	probably benign	Het
Esrp1	A	T	4: 11,357,603	M503K	probably benign	Het
Fam83e	G	T	7: 45,722,183	M1I	probably null	Het
Flt4	G	A	11: 49,635,698	A835T	probably benign	Het
Hdac4	T	C	1: 91,975,522	S562G	probably null	Het
Hist1h2bn	A	G	13: 21,754,277	D52G	probably damaging	Het
Icosl	A	G	10: 78,073,925	T235A	possibly damaging	Het
Itga6	A	G	2: 71,825,617	D295G	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lipa	A	T	19: 34,524,799	L15Q	probably benign	Het
Mcc	T	C	18: 44,534,230	E218G	possibly damaging	Het
Mdga2	A	G	12: 66,473,196		probably null	Het
Mmadhc	A	C	2: 50,288,946	C153W	probably damaging	Het
Myh1	A	G	11: 67,221,604	D1799G	probably damaging	Het
Nlrp1b	T	A	11: 71,169,795	Q729L	probably damaging	Het
Ofcc1	T	A	13: 40,180,448	Q389L	probably benign	Het
Olfr1030	A	G	2: 85,984,068	D76G	probably damaging	Het
Olfr469	T	C	7: 107,822,615	I285V	probably benign	Het
Olfr481	A	T	7: 108,081,036	M81L	possibly damaging	Het
Olfr691	A	G	7: 105,337,602	V38A	probably benign	Het
Pml	T	C	9: 58,234,874	N225S	probably benign	Het
Rnf213	A	G	11: 119,430,361	E1215G	probably benign	Het
Scap	T	A	9: 110,377,693	I402N	probably damaging	Het
Sgsm2	A	G	11: 74,853,082	L886P	probably damaging	Het
Sugct	T	C	13: 17,662,266	I104V	probably benign	Het
Tmem200c	A	G	17: 68,840,686	Q88R	probably damaging	Het
Tnfrsf1a	T	A	6: 125,357,805	L14Q	probably benign	Het
Tnk2	C	T	16: 32,671,421	L381F	probably damaging	Het
V1ra8	A	C	6: 90,202,962	D49A	probably damaging	Het
Vmn2r5	A	C	3: 64,509,593	M48R	probably benign	Het
Yars	A	G	4: 129,206,189	I227V	probably damaging	Het
Zfp850	C	A	7: 27,989,055	R576L	probably benign	Het
Zfpm2	T	A	15: 41,101,183	F223I	possibly damaging	Het

Other mutations in Ubr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Ubr2	APN	17	46986060	splice site	probably benign
IGL00332:Ubr2	APN	17	46990990	critical splice donor site	probably null
IGL00518:Ubr2	APN	17	46992996	missense	probably damaging	1.00
IGL00693:Ubr2	APN	17	46972981	missense	probably benign	0.01
IGL00785:Ubr2	APN	17	46944865	missense	possibly damaging	0.69
IGL01144:Ubr2	APN	17	46957321	missense	probably damaging	1.00
IGL01459:Ubr2	APN	17	46930509	splice site	probably benign
IGL01637:Ubr2	APN	17	46956654	missense	probably damaging	1.00
IGL01710:Ubr2	APN	17	46943409	missense	probably benign	0.00
IGL01726:Ubr2	APN	17	46992981	splice site	probably benign
IGL01925:Ubr2	APN	17	46954949	missense	possibly damaging	0.92
IGL01960:Ubr2	APN	17	46973967	missense	probably benign	0.45
IGL02170:Ubr2	APN	17	46967197	missense	probably benign	0.05
IGL02308:Ubr2	APN	17	46934193	missense	probably damaging	1.00
IGL02387:Ubr2	APN	17	46963150	missense	probably benign
IGL02696:Ubr2	APN	17	46963765	missense	probably benign
IGL02726:Ubr2	APN	17	46972921	missense	probably damaging	1.00
IGL02750:Ubr2	APN	17	46969282	missense	probably benign	0.00
IGL02934:Ubr2	APN	17	46957340	missense	possibly damaging	0.50
IGL02959:Ubr2	APN	17	46975951	missense	probably damaging	0.96
IGL03018:Ubr2	APN	17	46954046	missense	possibly damaging	0.64
IGL03343:Ubr2	APN	17	46951918	missense	probably benign	0.00
PIT4280001:Ubr2	UTSW	17	46944863	missense	probably damaging	1.00
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0044:Ubr2	UTSW	17	46992985	splice site	probably benign
R0446:Ubr2	UTSW	17	46983298	missense	probably damaging	1.00
R0513:Ubr2	UTSW	17	46986779	nonsense	probably null
R0565:Ubr2	UTSW	17	46955886	missense	probably damaging	1.00
R0600:Ubr2	UTSW	17	46967248	missense	probably damaging	0.99
R0690:Ubr2	UTSW	17	46938653	missense	probably damaging	0.97
R0710:Ubr2	UTSW	17	46938681	missense	probably damaging	0.96
R0761:Ubr2	UTSW	17	46983316	missense	probably damaging	1.00
R0798:Ubr2	UTSW	17	46969176	splice site	probably benign
R0862:Ubr2	UTSW	17	46967083	nonsense	probably null
R0947:Ubr2	UTSW	17	46941112	missense	probably damaging	0.99
R0972:Ubr2	UTSW	17	46934261	intron	probably null
R1500:Ubr2	UTSW	17	46986689	missense	possibly damaging	0.79
R1514:Ubr2	UTSW	17	47000823	missense	probably damaging	1.00
R1533:Ubr2	UTSW	17	46967247	nonsense	probably null
R1554:Ubr2	UTSW	17	46972951	missense	probably benign
R1575:Ubr2	UTSW	17	46932492	missense	probably damaging	1.00
R1602:Ubr2	UTSW	17	46941061	missense	probably benign	0.30
R1941:Ubr2	UTSW	17	46974026	missense	probably damaging	1.00
R1966:Ubr2	UTSW	17	46954919	missense	probably benign	0.05
R2041:Ubr2	UTSW	17	46986047	missense	probably damaging	1.00
R2067:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2111:Ubr2	UTSW	17	46963145	critical splice donor site	probably null
R2219:Ubr2	UTSW	17	46986042	missense	possibly damaging	0.94
R2307:Ubr2	UTSW	17	46966215	nonsense	probably null
R3426:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3428:Ubr2	UTSW	17	46968439	missense	probably damaging	1.00
R3608:Ubr2	UTSW	17	46944523	missense	probably damaging	1.00
R4080:Ubr2	UTSW	17	46988722	missense	probably benign	0.05
R4330:Ubr2	UTSW	17	46967278	missense	probably null	1.00
R4383:Ubr2	UTSW	17	46939387	missense	probably benign	0.01
R4460:Ubr2	UTSW	17	46945045	critical splice donor site	probably null
R4794:Ubr2	UTSW	17	46930445	missense	probably damaging	1.00
R4902:Ubr2	UTSW	17	46985996	missense	possibly damaging	0.91
R4913:Ubr2	UTSW	17	46959459	splice site	probably null
R5092:Ubr2	UTSW	17	46969247	missense	probably damaging	1.00
R5209:Ubr2	UTSW	17	46968424	missense	probably damaging	1.00
R5226:Ubr2	UTSW	17	46983270	missense	probably benign	0.04
R5250:Ubr2	UTSW	17	46930442	missense	probably benign	0.01
R5437:Ubr2	UTSW	17	46963697	missense	probably benign	0.00
R5607:Ubr2	UTSW	17	46934200	nonsense	probably null
R5848:Ubr2	UTSW	17	46956655	missense	possibly damaging	0.84
R6089:Ubr2	UTSW	17	46982292	missense	possibly damaging	0.95
R6382:Ubr2	UTSW	17	46957315	missense	possibly damaging	0.56
R6552:Ubr2	UTSW	17	46966268	splice site	probably null
R6630:Ubr2	UTSW	17	46951984	missense	possibly damaging	0.51
R6892:Ubr2	UTSW	17	46934108	missense	probably damaging	0.99
R6936:Ubr2	UTSW	17	46973031	missense	possibly damaging	0.94
R7039:Ubr2	UTSW	17	47010213	missense	probably benign	0.01
R7050:Ubr2	UTSW	17	46961602	missense	probably benign	0.30
R7078:Ubr2	UTSW	17	46955853	missense	possibly damaging	0.59
R7126:Ubr2	UTSW	17	46974056	splice site	probably null
R7219:Ubr2	UTSW	17	46935434	nonsense	probably null
R7262:Ubr2	UTSW	17	47000739	missense	probably damaging	0.97
R7352:Ubr2	UTSW	17	46930426	missense	probably benign	0.19
R7366:Ubr2	UTSW	17	46955845	missense	probably damaging	0.99
R7449:Ubr2	UTSW	17	46964788	missense	probably damaging	1.00
R7496:Ubr2	UTSW	17	46990991	critical splice donor site	probably null
R7759:Ubr2	UTSW	17	46986048	missense	probably damaging	1.00
R7869:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
R7952:Ubr2	UTSW	17	46991008	missense	probably benign	0.00
X0027:Ubr2	UTSW	17	47000629	missense	probably damaging	0.99
X0061:Ubr2	UTSW	17	46970111	missense	possibly damaging	0.88
Z1177:Ubr2	UTSW	17	46959509	missense	probably benign
Z1177:Ubr2	UTSW	17	47000766	missense	possibly damaging	0.76
Z1177:Ubr2	UTSW	17	47010143	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- GGTATTCTGAAACACAGCATTAGC -3'
(R):5'- TTTAAATGAGGGCTAAGCTGGG -3'

Sequencing Primer
(F):5'- AGCTGAGCTTAACTTACTCTGTG -3'
(R):5'- AAGAGATCCCGGGAGCGC -3'

Posted On

2014-10-02