Incidental Mutation 'R2189:Lipa'
ID237997
Institutional Source Beutler Lab
Gene Symbol Lipa
Ensembl Gene ENSMUSG00000024781
Gene Namelysosomal acid lipase A
SynonymsLal, Lip1, Lip-1
MMRRC Submission 040191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2189 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34492318-34527474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34524799 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 15 (L15Q)
Ref Sequence ENSEMBL: ENSMUSP00000136967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049572] [ENSMUST00000178114]
Predicted Effect probably benign
Transcript: ENSMUST00000049572
AA Change: L15Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000053270
Gene: ENSMUSG00000024781
AA Change: L15Q

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.4e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.6e-11 PFAM
Pfam:Abhydrolase_6 80 382 2.2e-10 PFAM
Pfam:Abhydrolase_1 111 388 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178114
AA Change: L15Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136967
Gene: ENSMUSG00000024781
AA Change: L15Q

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.3e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.5e-11 PFAM
Pfam:Abhydrolase_1 78 379 3.9e-31 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice show massive accumulation of triglycerides and cholesteryl esters in several organs, depletion of white and brown fat, hepatosplenomegaly, increased energy intake and plasma free fatty acid levels, insulin resistance, lung inflammation, alveolar destruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G C 7: 79,098,091 G870A probably damaging Het
Adamtsl2 T C 2: 27,081,738 W12R probably benign Het
Bsph1 G A 7: 13,470,329 probably null Het
Celsr1 G T 15: 85,979,230 H1200Q possibly damaging Het
Clptm1 A T 7: 19,637,145 Y355* probably null Het
Cry2 T C 2: 92,411,692 E572G possibly damaging Het
Dlk1 G A 12: 109,455,049 probably null Het
Eral1 A G 11: 78,075,831 V201A probably benign Het
Esrp1 A T 4: 11,357,603 M503K probably benign Het
Fam83e G T 7: 45,722,183 M1I probably null Het
Flt4 G A 11: 49,635,698 A835T probably benign Het
Hdac4 T C 1: 91,975,522 S562G probably null Het
Hist1h2bn A G 13: 21,754,277 D52G probably damaging Het
Icosl A G 10: 78,073,925 T235A possibly damaging Het
Itga6 A G 2: 71,825,617 D295G probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mcc T C 18: 44,534,230 E218G possibly damaging Het
Mdga2 A G 12: 66,473,196 probably null Het
Mmadhc A C 2: 50,288,946 C153W probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Nlrp1b T A 11: 71,169,795 Q729L probably damaging Het
Ofcc1 T A 13: 40,180,448 Q389L probably benign Het
Olfr1030 A G 2: 85,984,068 D76G probably damaging Het
Olfr469 T C 7: 107,822,615 I285V probably benign Het
Olfr481 A T 7: 108,081,036 M81L possibly damaging Het
Olfr691 A G 7: 105,337,602 V38A probably benign Het
Pml T C 9: 58,234,874 N225S probably benign Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Scap T A 9: 110,377,693 I402N probably damaging Het
Sgsm2 A G 11: 74,853,082 L886P probably damaging Het
Sugct T C 13: 17,662,266 I104V probably benign Het
Tmem200c A G 17: 68,840,686 Q88R probably damaging Het
Tnfrsf1a T A 6: 125,357,805 L14Q probably benign Het
Tnk2 C T 16: 32,671,421 L381F probably damaging Het
Ubr2 C T 17: 46,943,364 V1454I probably benign Het
V1ra8 A C 6: 90,202,962 D49A probably damaging Het
Vmn2r5 A C 3: 64,509,593 M48R probably benign Het
Yars A G 4: 129,206,189 I227V probably damaging Het
Zfp850 C A 7: 27,989,055 R576L probably benign Het
Zfpm2 T A 15: 41,101,183 F223I possibly damaging Het
Other mutations in Lipa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Lipa APN 19 34494035 missense probably damaging 1.00
IGL02517:Lipa APN 19 34494122 missense possibly damaging 0.47
IGL02869:Lipa APN 19 34493997 missense probably benign 0.01
IGL02869:Lipa APN 19 34493971 utr 3 prime probably benign
buckboard UTSW 19 34524746 missense probably benign 0.04
Pashtun UTSW 19 34510928 missense probably damaging 1.00
suri UTSW 19 34501634 nonsense probably null
R0071:Lipa UTSW 19 34495082 missense probably damaging 1.00
R0244:Lipa UTSW 19 34501541 missense probably damaging 1.00
R1871:Lipa UTSW 19 34510928 missense probably damaging 1.00
R1929:Lipa UTSW 19 34510890 nonsense probably null
R2270:Lipa UTSW 19 34510890 nonsense probably null
R2271:Lipa UTSW 19 34510890 nonsense probably null
R2272:Lipa UTSW 19 34510890 nonsense probably null
R4737:Lipa UTSW 19 34501634 nonsense probably null
R5713:Lipa UTSW 19 34523432 missense probably benign 0.00
R6381:Lipa UTSW 19 34524746 missense probably benign 0.04
R8338:Lipa UTSW 19 34494077 missense probably benign 0.01
RF012:Lipa UTSW 19 34509098 missense probably damaging 1.00
X0067:Lipa UTSW 19 34509020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACTGTAGCTTGGCATCTG -3'
(R):5'- AAACAGATTGATGTCCCCGCC -3'

Sequencing Primer
(F):5'- CACTTGTCATCACGGCAT -3'
(R):5'- AGAGACCGCTGGAGTCGTTTG -3'
Posted On2014-10-02