Incidental Mutation 'R0180:Zfp217'
ID23800
Institutional Source Beutler Lab
Gene Symbol Zfp217
Ensembl Gene ENSMUSG00000052056
Gene Namezinc finger protein 217
Synonyms4933431C08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R0180 (G1)
Quality Score196
Status Validated (trace)
Chromosome2
Chromosomal Location170108643-170148103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 170120137 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 90 (L90Q)
Ref Sequence ENSEMBL: ENSMUSP00000104783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063710] [ENSMUST00000109155]
Predicted Effect probably damaging
Transcript: ENSMUST00000063710
AA Change: L90Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067334
Gene: ENSMUSG00000052056
AA Change: L90Q

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109155
AA Change: L90Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104783
Gene: ENSMUSG00000052056
AA Change: L90Q

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149318
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Other mutations in Zfp217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Zfp217 APN 2 170115149 missense probably benign
IGL02412:Zfp217 APN 2 170112502 utr 3 prime probably benign
IGL02435:Zfp217 APN 2 170119453 missense possibly damaging 0.56
IGL03152:Zfp217 APN 2 170119052 missense probably damaging 1.00
PIT4581001:Zfp217 UTSW 2 170114583 missense probably benign 0.01
R0107:Zfp217 UTSW 2 170114874 nonsense probably null
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0110:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0200:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0279:Zfp217 UTSW 2 170119780 missense probably benign 0.28
R0395:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0396:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0453:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0510:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0512:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0513:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0653:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R1549:Zfp217 UTSW 2 170114470 missense probably benign 0.00
R3420:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3421:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3422:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3726:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R3731:Zfp217 UTSW 2 170114388 missense probably benign 0.31
R3926:Zfp217 UTSW 2 170112518 missense probably damaging 1.00
R4051:Zfp217 UTSW 2 170112616 critical splice acceptor site probably null
R4289:Zfp217 UTSW 2 170114787 missense probably benign 0.01
R4606:Zfp217 UTSW 2 170119750 missense possibly damaging 0.67
R4948:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R5113:Zfp217 UTSW 2 170114058 splice site probably null
R5734:Zfp217 UTSW 2 170119144 missense possibly damaging 0.57
R6228:Zfp217 UTSW 2 170119577 missense probably benign 0.01
R6452:Zfp217 UTSW 2 170119294 missense probably benign
R6782:Zfp217 UTSW 2 170116258 missense probably damaging 1.00
R7212:Zfp217 UTSW 2 170114152 missense probably benign 0.41
R8094:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8095:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8119:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8120:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8134:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8136:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8150:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8151:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
R8152:Zfp217 UTSW 2 170119651 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACATGCTGCACCCATACGTGAAG -3'
(R):5'- TACCCATCCTGTCAGACCCTGAAG -3'

Sequencing Primer
(F):5'- CATACGTGAAGGAGTCCTTATGC -3'
(R):5'- ATGATGCTGTGCCCATAAAAG -3'
Posted On2013-04-16