Incidental Mutation 'R2190:Pkp1'
ID238000
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
MMRRC Submission 040192-MU
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R2190 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135879971 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 520 (S520G)
Ref Sequence ENSEMBL: ENSMUSP00000128418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably benign
Transcript: ENSMUST00000027667
AA Change: S520G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: S520G

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132793
Predicted Effect probably benign
Transcript: ENSMUST00000163260
AA Change: S520G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: S520G

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189805
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,040,153 T56S probably damaging Het
Acbd6 A T 1: 155,624,906 H204L probably damaging Het
Acnat2 T A 4: 49,383,551 M1L probably benign Het
Adgrg5 A T 8: 94,933,951 I73F probably damaging Het
Ankrd52 A G 10: 128,383,618 T474A probably benign Het
Arid3a A G 10: 79,946,531 D252G possibly damaging Het
Aspg G T 12: 112,124,888 E501D probably damaging Het
Bicral A G 17: 46,825,123 I387T probably damaging Het
Bub1 T C 2: 127,810,725 N574S probably benign Het
Casr G A 16: 36,495,416 T764M probably damaging Het
Ccdc129 A G 6: 55,897,700 T212A possibly damaging Het
Ccdc60 A G 5: 116,157,580 S259P probably damaging Het
Ccne2 A T 4: 11,197,241 N181I probably benign Het
Chd4 A G 6: 125,114,297 D89G probably benign Het
Col25a1 C T 3: 130,584,715 P606S probably damaging Het
Dcc A G 18: 71,547,420 S582P possibly damaging Het
Dlg4 A G 11: 70,042,604 D619G probably damaging Het
Elavl2 C T 4: 91,264,094 V129I probably benign Het
Epha3 A G 16: 63,546,189 I965T probably benign Het
Fbxw16 G A 9: 109,436,671 S360L probably damaging Het
Fgf14 T C 14: 123,983,918 Y158C probably damaging Het
Gm44511 A G 6: 128,826,200 I16T possibly damaging Het
Has2 C A 15: 56,667,787 V511F probably benign Het
Heatr5b G A 17: 78,801,756 R1025C probably damaging Het
Hsd17b12 T C 2: 94,034,063 Y233C probably benign Het
Il1f5 A T 2: 24,280,819 I43F probably damaging Het
Inpp5b T A 4: 124,785,195 I465N probably damaging Het
Irak2 T A 6: 113,686,943 N423K probably damaging Het
Itga2 C A 13: 114,870,605 V396L probably benign Het
Lipo2 A T 19: 33,748,569 N94K probably damaging Het
Lrrc37a T C 11: 103,500,043 T1519A possibly damaging Het
Macf1 A G 4: 123,459,212 V1558A probably benign Het
Mocos C A 18: 24,664,057 H91Q probably benign Het
Myh14 G A 7: 44,661,063 T132I probably damaging Het
Nlrp2 A T 7: 5,319,238 D803E possibly damaging Het
Ntsr2 T A 12: 16,654,017 I173N probably damaging Het
Olfr1458 T G 19: 13,102,493 K270N probably damaging Het
Olfr299 A G 7: 86,466,365 Y318C possibly damaging Het
Pitx3 T C 19: 46,137,047 Y86C probably damaging Het
Pygo1 C T 9: 72,945,247 Q239* probably null Het
Rab13 A G 3: 90,223,544 E68G probably damaging Het
Rfx7 A G 9: 72,617,919 E797G probably benign Het
Slc5a1 T C 5: 33,104,593 probably null Het
Slco1c1 A G 6: 141,563,167 T518A probably benign Het
Spint1 A G 2: 119,238,180 I132V probably benign Het
Stard9 T A 2: 120,714,120 I4514N probably benign Het
Tenm3 T G 8: 48,395,544 S87R probably damaging Het
Thap4 G T 1: 93,750,659 P135Q probably damaging Het
Tmed9 A G 13: 55,593,343 E57G probably benign Het
Tnrc18 C T 5: 142,775,889 V594I unknown Het
Trmt1 A T 8: 84,689,841 K64* probably null Het
Usf2 A G 7: 30,955,181 V198A probably damaging Het
Usp14 A T 18: 10,007,835 C168S probably damaging Het
Vav3 C A 3: 109,562,814 T525K probably damaging Het
Vmn1r52 A G 6: 90,179,169 I152V probably benign Het
Vmn2r81 A G 10: 79,268,251 D236G possibly damaging Het
Wdr19 G A 5: 65,244,166 V975I possibly damaging Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0180:Pkp1 UTSW 1 135886800 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0368:Pkp1 UTSW 1 135886852 missense probably benign 0.00
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R0725:Pkp1 UTSW 1 135880740 missense probably benign 0.02
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4838:Pkp1 UTSW 1 135882588 missense probably damaging 1.00
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R5908:Pkp1 UTSW 1 135918883 nonsense probably null
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R6232:Pkp1 UTSW 1 135886861 missense probably benign 0.01
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCGAGAAAGGATAGTCTG -3'
(R):5'- AGAGAACCATGGTCCATTCCC -3'

Sequencing Primer
(F):5'- ATAGTCTGGTGGGAGATGCAG -3'
(R):5'- CACTTTGGTGATTCTAGGATGCACAG -3'
Posted On2014-10-02