Incidental Mutation 'R0180:Celf3'
ID23801
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94485340 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 115 (F115L)
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000198316] [ENSMUST00000198384] [ENSMUST00000199775] [ENSMUST00000200342] [ENSMUST00000199884]
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: F114L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: F114L

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect possibly damaging
Transcript: ENSMUST00000197558
AA Change: F38L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137
AA Change: F38L

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197677
AA Change: F39L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137
AA Change: F39L

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect probably damaging
Transcript: ENSMUST00000198316
AA Change: F38L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137
AA Change: F38L

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198384
AA Change: F39L

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137
AA Change: F39L

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: F115L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: F115L

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200342
AA Change: F115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: F115L

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Meta Mutation Damage Score 0.5973 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0670:Celf3 UTSW 3 94488230 small deletion probably benign
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3548:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R5851:Celf3 UTSW 3 94479126 missense probably damaging 1.00
R6277:Celf3 UTSW 3 94485365 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94480330 missense probably damaging 0.99
R7556:Celf3 UTSW 3 94480283 missense probably damaging 1.00
R8141:Celf3 UTSW 3 94488543 missense probably damaging 1.00
R8290:Celf3 UTSW 3 94479182 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGCCAAGTAGAGTTCACGTCCTTC -3'
(R):5'- TCTGGAACTTCACAAAGGCACAGC -3'

Sequencing Primer
(F):5'- AGCCACAGTTTCCCAGGATG -3'
(R):5'- CACAGCCTAGAGTAAGTGGATG -3'
Posted On2013-04-16