Incidental Mutation 'R2190:Usf2'
ID238032
Institutional Source Beutler Lab
Gene Symbol Usf2
Ensembl Gene ENSMUSG00000058239
Gene Nameupstream transcription factor 2
SynonymsUsf-2, bHLHb12
MMRRC Submission 040192-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R2190 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30945248-30956803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30955181 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000132256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058860] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000108119] [ENSMUST00000147431] [ENSMUST00000162228] [ENSMUST00000170699] [ENSMUST00000172417] [ENSMUST00000205961]
Predicted Effect probably benign
Transcript: ENSMUST00000001279
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058860
AA Change: V198A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132256
Gene: ENSMUSG00000058239
AA Change: V198A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
HLH 241 296 1.36e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098553
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108116
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108119
AA Change: V131A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132021
Gene: ENSMUSG00000058239
AA Change: V131A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
HLH 174 229 1.36e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133179
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162228
AA Change: V171A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125520
Gene: ENSMUSG00000058239
AA Change: V171A

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
HLH 214 269 1.36e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169496
Predicted Effect unknown
Transcript: ENSMUST00000170442
AA Change: V152A
SMART Domains Protein: ENSMUSP00000130298
Gene: ENSMUSG00000058239
AA Change: V152A

DomainStartEndE-ValueType
low complexity region 41 65 N/A INTRINSIC
HLH 196 243 1.83e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000170699
AA Change: S47P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171338
Predicted Effect probably benign
Transcript: ENSMUST00000172417
SMART Domains Protein: ENSMUSP00000132833
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
HLH 110 165 1.36e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181395
Predicted Effect probably benign
Transcript: ENSMUST00000205961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206345
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix leucine zipper family of transcription factors. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs and is involved in regulating multiple cellular processes. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mutants are 20-40% smaller at birth and > 50% die postnatally, possibly because they are unable to nurse. In survivors, a proportionate dwarfism is maintained into adulthood. Males are usually infertile and die before 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,040,153 T56S probably damaging Het
Acbd6 A T 1: 155,624,906 H204L probably damaging Het
Acnat2 T A 4: 49,383,551 M1L probably benign Het
Adgrg5 A T 8: 94,933,951 I73F probably damaging Het
Ankrd52 A G 10: 128,383,618 T474A probably benign Het
Arid3a A G 10: 79,946,531 D252G possibly damaging Het
Aspg G T 12: 112,124,888 E501D probably damaging Het
Bicral A G 17: 46,825,123 I387T probably damaging Het
Bub1 T C 2: 127,810,725 N574S probably benign Het
Casr G A 16: 36,495,416 T764M probably damaging Het
Ccdc129 A G 6: 55,897,700 T212A possibly damaging Het
Ccdc60 A G 5: 116,157,580 S259P probably damaging Het
Ccne2 A T 4: 11,197,241 N181I probably benign Het
Chd4 A G 6: 125,114,297 D89G probably benign Het
Col25a1 C T 3: 130,584,715 P606S probably damaging Het
Dcc A G 18: 71,547,420 S582P possibly damaging Het
Dlg4 A G 11: 70,042,604 D619G probably damaging Het
Elavl2 C T 4: 91,264,094 V129I probably benign Het
Epha3 A G 16: 63,546,189 I965T probably benign Het
Fbxw16 G A 9: 109,436,671 S360L probably damaging Het
Fgf14 T C 14: 123,983,918 Y158C probably damaging Het
Gm44511 A G 6: 128,826,200 I16T possibly damaging Het
Has2 C A 15: 56,667,787 V511F probably benign Het
Heatr5b G A 17: 78,801,756 R1025C probably damaging Het
Hsd17b12 T C 2: 94,034,063 Y233C probably benign Het
Il1f5 A T 2: 24,280,819 I43F probably damaging Het
Inpp5b T A 4: 124,785,195 I465N probably damaging Het
Irak2 T A 6: 113,686,943 N423K probably damaging Het
Itga2 C A 13: 114,870,605 V396L probably benign Het
Lipo2 A T 19: 33,748,569 N94K probably damaging Het
Lrrc37a T C 11: 103,500,043 T1519A possibly damaging Het
Macf1 A G 4: 123,459,212 V1558A probably benign Het
Mocos C A 18: 24,664,057 H91Q probably benign Het
Myh14 G A 7: 44,661,063 T132I probably damaging Het
Nlrp2 A T 7: 5,319,238 D803E possibly damaging Het
Ntsr2 T A 12: 16,654,017 I173N probably damaging Het
Olfr1458 T G 19: 13,102,493 K270N probably damaging Het
Olfr299 A G 7: 86,466,365 Y318C possibly damaging Het
Pitx3 T C 19: 46,137,047 Y86C probably damaging Het
Pkp1 T C 1: 135,879,971 S520G probably benign Het
Pygo1 C T 9: 72,945,247 Q239* probably null Het
Rab13 A G 3: 90,223,544 E68G probably damaging Het
Rfx7 A G 9: 72,617,919 E797G probably benign Het
Slc5a1 T C 5: 33,104,593 probably null Het
Slco1c1 A G 6: 141,563,167 T518A probably benign Het
Spint1 A G 2: 119,238,180 I132V probably benign Het
Stard9 T A 2: 120,714,120 I4514N probably benign Het
Tenm3 T G 8: 48,395,544 S87R probably damaging Het
Thap4 G T 1: 93,750,659 P135Q probably damaging Het
Tmed9 A G 13: 55,593,343 E57G probably benign Het
Tnrc18 C T 5: 142,775,889 V594I unknown Het
Trmt1 A T 8: 84,689,841 K64* probably null Het
Usp14 A T 18: 10,007,835 C168S probably damaging Het
Vav3 C A 3: 109,562,814 T525K probably damaging Het
Vmn1r52 A G 6: 90,179,169 I152V probably benign Het
Vmn2r81 A G 10: 79,268,251 D236G possibly damaging Het
Wdr19 G A 5: 65,244,166 V975I possibly damaging Het
Other mutations in Usf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Usf2 APN 7 30946992 nonsense probably null
IGL02990:Usf2 APN 7 30955307 missense probably benign
R0332:Usf2 UTSW 7 30955179 missense possibly damaging 0.95
R0513:Usf2 UTSW 7 30954736 unclassified probably benign
R1827:Usf2 UTSW 7 30955340 missense probably damaging 0.96
R1946:Usf2 UTSW 7 30956238 missense probably null
R3783:Usf2 UTSW 7 30955831 missense probably benign
R4744:Usf2 UTSW 7 30954772 missense probably damaging 1.00
R6372:Usf2 UTSW 7 30955313 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAATCCCCGTGAAGAGAGG -3'
(R):5'- ATTTTCCAGCATCCAGTGTGG -3'

Sequencing Primer
(F):5'- TGATACTTCCGAAGCAGAAGC -3'
(R):5'- AGCATCCAGTGTGGGCGATAC -3'
Posted On2014-10-02